miRBase entry: hsa-mir-432

Stem-loop hsa-mir-432


Accession
MI0003133
Symbol
HGNC: MIR432
Description
Homo sapiens hsa-mir-432 precursor miRNA mir-432
Gene
family?
RF00775; mir-432

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR432 is a microRNA that has been implicated in various biological processes and diseases. In a study, it was found that MIR432, along with other miRNAs, was a target for miR324-5p and was located near the promoter regions of NR6A1, POU3F2, CUTL1, PAX8, and AHR transcription factors [PMC4619381]. In the context of ovarian cancer drug resistance, it was hypothesized that MIR432 may also play a role in drug resistance in lung adenocarcinoma (LAD) [PMC4991437]. The study found a negative correlation between the levels of MIR432 and the levels of E2F3 and AXL in LAD [PMC4991437]. Additionally, decreased levels of MIR432 were observed along with other miRNAs (MIR700 and MIR692-1), which could contribute to relieved post-transcriptional gene repression [PMC4077804]. However, direct binding of p53 to MIR432 could not be confirmed in a neuroblastoma cell line with wild-type p53 [PMC4356961]. In another study investigating genetic associations at the 14q32 region, SNP rs2400963 and its flanking genes (including MIR432) were identified at this locus [PMC6202974]. Overall, these findings suggest that MIR432 may have functional roles in drug resistance and gene regulation.

Literature search
42 open access papers mention hsa-mir-432
(384 sentences)

Sequence

21169 reads, 163 reads per million, 76 experiments
ugacuccuccaggUCUUGGAGUAGGUCAUUGGGUGGauccucuauuuccuuacgugggccaCUGGAUGGCUCCUCCAUGUCUuggaguagauca
(((((.(((((((.(.(((((..(((((((.(((((.(((.(((......)).).)))))))).))))))).))))).).))))))).)).)))

Structure
   -  c       U U     UA       G     a   u -  uu 
uga cu cuccagg C UGGAG  GGUCAUU GGUGG ucc c ua  u
||| || ||||||| | |||||  ||||||| ||||| ||| | ||   
acu ga gagguUC G ACCUC  UCGGUAG UCacc ggg g au  c
   a  u       U U     -C       G     -   u c  uc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr14: 100884483-100884576 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from hsa-mir-432
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-432 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-432-5p

Accession MIMAT0002814
Description Homo sapiens hsa-miR-432-5p mature miRNA
Sequence 14 - UCUUGGAGUAGGUCAUUGGGUGG - 36
Evidence experimental
array-cloned [1], cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-432-3p

Accession MIMAT0002815
Description Homo sapiens hsa-miR-432-3p mature miRNA
Sequence 62 - CUGGAUGGCUCCUCCAUGUCU - 82
Evidence experimental
array-cloned [1]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267