MIR432 is a microRNA that has been implicated in various biological processes and diseases. In a study, it was found that MIR432, along with other miRNAs, was a target for miR324-5p and was located near the promoter regions of NR6A1, POU3F2, CUTL1, PAX8, and AHR transcription factors [PMC4619381]. In the context of ovarian cancer drug resistance, it was hypothesized that MIR432 may also play a role in drug resistance in lung adenocarcinoma (LAD) [PMC4991437]. The study found a negative correlation between the levels of MIR432 and the levels of E2F3 and AXL in LAD [PMC4991437]. Additionally, decreased levels of MIR432 were observed along with other miRNAs (MIR700 and MIR692-1), which could contribute to relieved post-transcriptional gene repression [PMC4077804]. However, direct binding of p53 to MIR432 could not be confirmed in a neuroblastoma cell line with wild-type p53 [PMC4356961]. In another study investigating genetic associations at the 14q32 region, SNP rs2400963 and its flanking genes (including MIR432) were identified at this locus [PMC6202974]. Overall, these findings suggest that MIR432 may have functional roles in drug resistance and gene regulation.
- c U U UA G a u - uu uga cu cuccagg C UGGAG GGUCAUU GGUGG ucc c ua u ||| || ||||||| | ||||| ||||||| ||||| ||| | || acu ga gagguUC G ACCUC UCGGUAG UCacc ggg g au c a u U U -C G - u c uc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002814 |
Description | Homo sapiens hsa-miR-432-5p mature miRNA |
Sequence | 14 - UCUUGGAGUAGGUCAUUGGGUGG - 36 |
Evidence |
experimental
array-cloned [1], cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002815 |
Description | Homo sapiens hsa-miR-432-3p mature miRNA |
Sequence | 62 - CUGGAUGGCUCCUCCAUGUCU - 82 |
Evidence |
experimental
array-cloned [1] |
|