miRBase entry: hsa-mir-432

Stem-loop hsa-mir-432


Accession
MI0003133
Symbol
HGNC: MIR432
Description
Homo sapiens hsa-mir-432 precursor miRNA mir-432
Gene
family?
RF00775; mir-432

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR432 is a microRNA gene that has been implicated in various biological processes and diseases, including lung adenocarcinoma (LAD) and drug resistance in ovarian cancer [PMC4991437]. In LAD, MIR432 expression is inversely related to the levels of E2F3 and AXL, suggesting a regulatory role in the disease's pathology [PMC4991437]. Additionally, MIR432 expression is significantly reduced in LAD, which may contribute to the alleviation of post-transcriptional gene repression [PMC4077804]. Despite its associations with cancer-related genes and pathways, direct binding of p53 to MIR432 has not been confirmed in neuroblastoma cell lines with wild-type p53 [PMC4356961]. Furthermore, MIR432 has been identified as one of the strongest microRNA genes through various statistical measures such as simP [PMC5144977], and its expression levels differ between sun-exposed and sun-protected skin in young donors compared to old age donors [PMC6113407]. The gene is located within the DLK1-DIO3 genomic region at 14q32, which is known for its complex imprinting and gene regulation mechanisms involving several small nucleolar RNAs (snoRNAs) and microRNAs including MIR431, MIR433, and MIR136 [PMC6202974].

Literature search
42 open access papers mention hsa-mir-432
(384 sentences)

Sequence

21168 reads, 71 reads per million, 76 experiments
ugacuccuccaggUCUUGGAGUAGGUCAUUGGGUGGauccucuauuuccuuacgugggccaCUGGAUGGCUCCUCCAUGUCUuggaguagauca
(((((.(((((((.(.(((((..(((((((.(((((.(((.(((......)).).)))))))).))))))).))))).).))))))).)).)))

Structure
   -  c       U U     UA       G     a   u -  uu 
uga cu cuccagg C UGGAG  GGUCAUU GGUGG ucc c ua  u
||| || ||||||| | |||||  ||||||| ||||| ||| | ||   
acu ga gagguUC G ACCUC  UCGGUAG UCacc ggg g au  c
   a  u       U U     -C       G     -   u c  uc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr14: 100884483-100884576 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from hsa-mir-432
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-432 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-432-5p

Accession MIMAT0002814
Description Homo sapiens hsa-miR-432-5p mature miRNA
Sequence 14 - UCUUGGAGUAGGUCAUUGGGUGG - 36
Evidence experimental
array-cloned [1], cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-432-3p

Accession MIMAT0002815
Description Homo sapiens hsa-miR-432-3p mature miRNA
Sequence 62 - CUGGAUGGCUCCUCCAUGUCU - 82
Evidence experimental
array-cloned [1]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267