MIR488 is identified as one of the differentially expressed microRNAs among 1403 genes, suggesting its potential regulatory role in gene expression [PMC4052096]. It was observed that leptin treatment significantly reduces the levels of MIR488 in mHypoA-POMC/GFP culture, indicating that leptin may influence MIR488 expression [PMC6947463]. Furthermore, MIR488 is implicated in the modulation of MMP-13 activity through its interaction with ZIP, which is induced by IL-1β [PMC3706240]. This microRNA also plays a role in inhibiting epithelial-mesenchymal transition (EMT) by targeting MAPK signaling pathways, which involves different proteins and receptors [PMC7602903]. Specifically, MIR488 has a cause-effect relationship with ZIP8 and is involved in reducing chondrocyte degradation in osteoarthritis [PMC3934988]. The importance of MIR488 extends to its potential involvement with zinc uptake transporters like ZIP8 that are crucial for bone health, particularly given the low bone mineral density observed in type 1 and type 2 diabetes (T1D and T2D) [PMC3934988]. However, the epigenetic effects of intermittent hypoxia (IH) on MIR488 levels have not yet been confirmed in certain models [PMC3934988]. Lastly, although levels of miR-218 and MIR488 are decreased in H. pylori-infected gastric cancer tissues, no significant difference was found between different H. pylori strains affecting these microRNA levels [PMC6365042].
a cu C U A C guu gaga ucaucu CC AGA AAUGGC CU UCAAacaa u |||| |||||| || ||| |||||| || |||||||| c cucu aguaga GG UCU UUAUCG GA AGUUuguu c c CU U - - A aaa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002804 |
Description | Homo sapiens hsa-miR-488-5p mature miRNA |
Sequence | 14 - CCCAGAUAAUGGCACUCUCAA - 34 |
Evidence |
experimental
array-cloned [1] |
Accession | MIMAT0004763 |
Description | Homo sapiens hsa-miR-488-3p mature miRNA |
Sequence | 52 - UUGAAAGGCUAUUUCUUGGUC - 72 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|