MIR488 is a microRNA that has been identified among the differentially expressed genes in various studies [PMC4052096]. Leptin treatment has been shown to decrease the levels of MIR488 in mHypoA-POMC/GFP culture [PMC6947463]. There is evidence to suggest that MIR488 may interact with ZIP and modulate MMP-13 activity [PMC3706240]. Additionally, MIR488, along with other microRNAs such as miR30a, miR9, miR1249, and miR497, has been found to inhibit epithelial-mesenchymal transition (EMT) through MAPK signaling [PMC7602903]. A recent study has reported a relationship between MIR488 and ZIP8 in osteoarthritis, where reduced degradation of chondrocytes was observed [PMC3934988]. The roles of zinc uptake transporters like ZIP8 and MIR488 may be crucial in bone health as low bone mineral density is a common symptom of type 1 and type 2 diabetes [PMC3934988'>PMC3934988]. However, the epigenetic effect of intermittent hypoxia on the amount of MIR488 has not been confirmed yet [PMC3934988]. In Helicobacter pylori-infected gastric cancer tissues, both miR-218 and MIR488 were found to be decreased but there was no significant difference between different H. pylori strains [PMC6365042]. References: - PMC4052096 - PMC6947463 - PMC3706240 - PMC7602903 - PMC3934988 - PMC6365042
a cu C U A C guu gaga ucaucu CC AGA AAUGGC CU UCAAacaa u |||| |||||| || ||| |||||| || |||||||| c cucu aguaga GG UCU UUAUCG GA AGUUuguu c c CU U - - A aaa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002804 |
Description | Homo sapiens hsa-miR-488-5p mature miRNA |
Sequence | 14 - CCCAGAUAAUGGCACUCUCAA - 34 |
Evidence |
experimental
array-cloned [1] |
Accession | MIMAT0004763 |
Description | Homo sapiens hsa-miR-488-3p mature miRNA |
Sequence | 52 - UUGAAAGGCUAUUUCUUGGUC - 72 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|