Stem-loop hsa-mir-484

Accession

MI0002468

Symbol

HGNC: MIR484

Description

Homo sapiens hsa-mir-484 precursor miRNA mir-484

Gene
family

RF00783; mir-484

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Hsa-mir-484 is a microRNA that is stably expressed in plasma and was chosen among other miRNAs for analysis using the BestKeeper software due to its limited intra-group variability expression [PMC8533962]. In a cohort study, hsa-mir-484 was found to be significantly different between multiple sclerosis (MS) patients and healthy subjects [PMC10062329]. Furthermore, the functional validation of hsa-mir-484 was demonstrated through an in vitro model that depicted the heterozygous deletion of MIR484, confirming its effect on miRNA expression and dysregulation of target genes [PMC9587983]. In silico analysis revealed that hsa-mir-484 is a predicted target of miR-1307, along with other miRNAs such as hsa-miR-193b-3p and hsa-miR-222-3p [PMC9578367].

Literature search

40 open access papers mention hsa-mir-484
(117 sentences)

Sequence

45073 reads, 612 reads per million, 123 experiments

agccucgUCAGGCUCAGUCCCCUCCCGAUaaaccccuaaauagggacuuucccggggggugacccuggcuuuuuuggcg
.(((..((((((....(((.(((((((..(((.((((....))))..)))..))))))).)))))))))......))).

Structure

a   ----uc      CUCA   C       AU   -c    a 
 gcc      gUCAGG    GUC CCUCCCG  aaa  cccu a
 |||      ||||||    ||| |||||||  |||  ||||  
 cgg      cggucc    cag ggggggc  uuu  ggga a
g   uuuuuu      ----   u       cc   ca    u 

Annotation confidence Not enough data

Genome context

chr16: 15643294-15643372 [+]

Disease association

hsa-mir-484 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-484

• Accession: MIMAT0002174
• Description: Homo sapiens hsa-miR-484 mature miRNA
• Sequence: 8 - UCAGGCUCAGUCCCCUCCCGAU - 29
• Evidence: experimental ; cloned [1-3], Northern [1]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854