MIR483 is identified as an oncogenic microRNA that plays a significant role in the regulation of IGF2 imprinting, as revealed through Cas9 immunoprecipitation techniques [PMC5470959]. This microRNA has been found to be overexpressed in the tissues of patients suffering from Bronchopulmonary Dysplasia (BPD), suggesting a potential involvement in the pathogenesis of bronchial mucosal necrosis and the impaired healing process post-injury [PMC9061009]. Furthermore, research involving MIR483 knockout (MIR483−/−) C2C12 cells has been conducted to assess its impact on cellular proliferation, particularly in cells with a disrupted ZBED6-Igf2 axis, which is crucial for understanding its phenotypic consequences [PMC8484269].
- A A G -u ucc gagggg gAAGACGGGAGGA AG AG GAG ggu a |||||| ||||||||||||| || || ||| ||| cucucc cUUCUGCCCUCCU UC UC CUc ccg u u C C A cu cac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004761 |
Description | Homo sapiens hsa-miR-483-5p mature miRNA |
Sequence | 8 - AAGACGGGAGGAAAGAAGGGAG - 29 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002173 |
Description | Homo sapiens hsa-miR-483-3p mature miRNA |
Sequence | 48 - UCACUCCUCUCCUCCCGUCUU - 68 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|