WARNING: This summary was generated by AI. MIR410 is a microRNA gene that has been implicated in the regulation of apoptosis in human pulmonary artery endothelial cells (hPAECs), as suggested by research indicating that NAMPT, a protein known to promote resistance to apoptosis, is associated with the function of MIR410 [PMC6616369]. Additionally, MIR410, along with MIR155, has been identified as playing a role in glucose metabolism [PMC8620086]. This connection to both apoptosis and glucose metabolism suggests that MIR410 may have multifaceted roles within cellular processes and could be a significant factor in the regulation of cellular homeostasis and disease states.
c g A A - uuuu
gguac ugagaa AGGUUGUCUGUG UG GUUCG c a
||||| |||||| |||||||||||| || ||||| |
ccaug acuuuU UCCGGUAGACAC AU UAAgc g u
- G A A a uaau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002171 |
| Description | Homo sapiens hsa-miR-410-3p mature miRNA |
| Sequence | 50 - AAUAUAACACAGAUGGCCUGU - 70 |
| Evidence |
experimental
array-cloned [2], cloned [3-5], Northern [3], Illumina [6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026558 |
| Description | Homo sapiens hsa-miR-410-5p mature miRNA |
| Sequence | 14 - AGGUUGUCUGUGAUGAGUUCG - 34 |
| Evidence |
experimental
Illumina [6] |
|