miRBase entry: gma-MIR156b

Stem-loop gma-MIR156b


Accession
MI0001790
Description
Glycine max gma-MIR156b precursor miRNA

Literature search
41 open access papers mention gma-MIR156b
(188 sentences)

Sequence


ugaugugagauaucucauguUGACAGAAGAGAGAGAGCACAacccgggaauggcuaaaggagucuuugccuuuguugggagugugcccucucuuccucugucaucaucacauucacaugc
..(((((((.......(((.(((((((.(((((((.(((((.(((((.((.(((.((((....))))))).)).)))))..))))).)))))))..))))))).)))....)))))))..

Structure
ug       auaucuc   u       -A       A     -a     g  u   u    g 
  augugag       aug UGACAGA  GAGAGAG GCACA  cccgg aa ggc aaag a
  |||||||       ||| |||||||  ||||||| |||||  ||||| || ||| ||||  
  uacacuu       uac acugucu  uucucuc cgugu  ggguu uu ccg uuuc g
cg       ---acac   u       cc       c     ga     g  u   -    u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr14: 992155-992274 [+]

Database links

Mature gma-miR156b

Accession MIMAT0001692
Description Glycine max gma-miR156b mature miRNA
Sequence 21 - UGACAGAAGAGAGAGAGCACA - 41
Evidence experimental
454 [2], Illumina [3-4]

References

  1. Conservation and divergence of microRNA families in plants
    "Dezulian T, Palatnik JF, Huson DH, Weigel D"
    Genome Biol. (2005) 6:P13

  2. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  3. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  4. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153