Stem-loop hsa-mir-409

Accession

MI0001735

Symbol

HGNC: MIR409

Description

Homo sapiens hsa-mir-409 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR409 is a microRNA implicated in various biological processes and diseases, including its deregulation in gastrointestinal stromal tumors (GISTs), where it is expressed higher in intestinal compared to gastric tumors [PMC5796982]. It is part of the DLK1-DIO3 genomic region and belongs to cluster B of the microRNA cluster [PMC7308478]. MIR409's downregulation has been associated with the early onset of fibrosis in livers co-infected with HCV and HIV, suggesting a role in extracellular matrix remodeling [PMC8869900]. It has been predicted to target genes such as SRY-box containing gene 6 (Sox6), which could have implications for various cellular functions [PMC4488424]. MIR409, along with other muscle-specific microRNAs, has been shown to induce induced cardiomyocytes (iCMs) from mouse cardiac fibroblasts, indicating its potential role in cardiac regeneration [PMC6679082]. Furthermore, MIR409's expression has been linked with traits such as weight and lean mass, suggesting its utility as a biomarker for weight loss [PMC5659802]. In pathological conditions like severe drug reactions (SJS/TEN) and pancreatic ductal adenocarcinoma (PDAC), MIR409's expression levels have been associated with disease progression and prognosis [PMC9027774], [PMC10057657].

Literature search

56 open access papers mention hsa-mir-409
(192 sentences)

Sequence

8528 reads, 122 reads per million, 121 experiments

ugguacucggggagAGGUUACCCGAGCAACUUUGCAUcuggacgacGAAUGUUGCUCGGUGAACCCCUuuucgguauca
((((((.(((((((.((((..((((((((((((((........).)))).)))))))))..)))).)))))))))))))

Structure

      u       A    AC         -    - AUc 
ugguac cggggag GGUU  CCGAGCAAC UUUG C   u
|||||| ||||||| ||||  ||||||||| |||| |    
acuaug gcuuuUC CCAA  GGCUCGUUG AAGc g   g
      -       C    GU         U    a cag 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr14: 101065300-101065378 [+]

Clustered miRNAs

10 other miRNAs are < 10 kb from hsa-mir-409

Disease association

hsa-mir-409 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-409-5p

• Accession: MIMAT0001638
• Description: Homo sapiens hsa-miR-409-5p mature miRNA
• Sequence: 15 - AGGUUACCCGAGCAACUUUGCAU - 37
• Evidence: experimental ; cloned [1,3-4]

Mature hsa-miR-409-3p

• Accession: MIMAT0001639
• Description: Homo sapiens hsa-miR-409-3p mature miRNA
• Sequence: 47 - GAAUGUUGCUCGGUGAACCCCU - 68
• Evidence: experimental ; cloned [1,3-4], array-cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


3. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


4. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267