MIR409 is a microRNA that has been studied in various contexts. In gastrointestinal stromal tumors (GISTs), the expression of MIR409 was found to be deregulated, with higher expression in intestinal tumors compared to gastric tumors [PMC5796982]. MIR409 was also found to be one of the representative miRNAs from the DLK1-DIO3 locus, specifically from cluster B [PMC7308478]. In double-infected transplanted livers, the downregulation of MIR409 was associated with the early onset of fibrosis [PMC8869900]. MIR409 has been predicted to target Sox6 and has been studied in the context of inducing induced cardiomyocytes (iCMs) from cardiac fibroblasts [PMC4488424] [PMC6679082]. Additionally, MIR409 has been identified as one of the miRNAs in the miR655 cluster and has available expression data [PMC7465874]. It has also been associated with various traits such as weight loss and lean mass [PMC5659802]. In CAP (community-acquired pneumonia), plasma levels of MIR409 were reduced compared to healthy controls [PMC8358855]. Furthermore, MIR409 was identified as a hub gene in SJS/TEN (Stevens-Johnson syndrome/toxic epidermal necrolysis) and has been reported in previous studies as differentially expressed miRNA [PMC9027774] [PMC4393113]. The association between copy number variations at 14q32.2-q32.31, including MIR409, and sensitivity to bleomycin in renal cell carcinoma cell lines was observed [PMC9716673]. Finally, predicted targets of MIR409 include CTNND1, CTNNA1, and CTNNB1 which have implications for pancreatic cancer prognosis proteins. [PMC10057657].
u A AC - - AUc ugguac cggggag GGUU CCGAGCAAC UUUG C u |||||| ||||||| |||| ||||||||| |||| | acuaug gcuuuUC CCAA GGCUCGUUG AAGc g g - C GU U a cag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001638 |
Description | Homo sapiens hsa-miR-409-5p mature miRNA |
Sequence | 15 - AGGUUACCCGAGCAACUUUGCAU - 37 |
Evidence |
experimental
cloned [1,3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0001639 |
Description | Homo sapiens hsa-miR-409-3p mature miRNA |
Sequence | 47 - GAAUGUUGCUCGGUGAACCCCU - 68 |
Evidence |
experimental
cloned [1,3-4], array-cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|