Stem-loop hsa-mir-452

Accession

MI0001733

Symbol

HGNC: MIR452

Description

Homo sapiens hsa-mir-452 precursor miRNA mir-452

Gene
family

RF00839; mir-452

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR452, a microRNA, was observed to be upregulated in colorectal cancer (CRC) tissues and in tissues affected by dextran sulfate sodium (DSS)-induced colitis, suggesting a role in inflammatory and cancer processes [PMC6826374]. This upregulation implicates MIR452 in the modulation of critical signaling pathways within CRC cells, specifically the VEGFA–VEGFR2-mediated pathways, which include VEGFR2–SRC–PTK2 and VEGFR2–KRAS–BRAF–MAPK [PMC6826374]. Through its regulation of these pathways, MIR452 influences CRC cell growth, migration, and angiogenesis [PMC6826374]. Experimental evidence supporting the regulatory role of MIR452 was provided by a reduction in luciferase activity by about 15% when CRC cells were co-transfected with a MIR452 mimic [PMC6826374]. This finding underscores the potential of MIR452 as a therapeutic target or biomarker for CRC due to its involvement in key cellular processes that drive tumor progression [PMC6826374].

Literature search

48 open access papers mention hsa-mir-452
(270 sentences)

Sequence

41327 reads, 581 reads per million, 109 experiments

gcuaagcacuuacAACUGUUUGCAGAGGAAACUGAgacuuuguaacuaugucucaguCUCAUCUGCAAAGAAGUAAGUGcuuugc
((.((((((((((...(.((((((((.((.((((((((...........)))))))).)).)))))))).).)))))))))).))

Structure

  u          AAC G        G  A        uuug 
gc aagcacuuac   U UUUGCAGA GA ACUGAgac    u
|| ||||||||||   | |||||||| || ||||||||    a
cg uucGUGAAUG   A AAACGUCU CU ugacucug    a
  u          --A G        A  C        uauc 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chrX: 151959628-151959712 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-452

Disease association

hsa-mir-452 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-452-5p

• Accession: MIMAT0001635
• Description: Homo sapiens hsa-miR-452-5p mature miRNA
• Sequence: 14 - AACUGUUUGCAGAGGAAACUGA - 35
• Evidence: experimental ; cloned [1,3-5], array-cloned [2]

Mature hsa-miR-452-3p

• Accession: MIMAT0001636
• Description: Homo sapiens hsa-miR-452-3p mature miRNA
• Sequence: 58 - CUCAUCUGCAAAGAAGUAAGUG - 79
• Evidence: experimental ; array-cloned [2], cloned [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


4. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267