Stem-loop hsa-mir-451a

Accession

MI0001729

Symbol

HGNC: MIR451A

Description

Homo sapiens hsa-mir-451a precursor miRNA mir-451

Gene
family

RF00722; mir-451

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Hsa-mir-451 is a microRNA that has been identified as a significant biomarker in various diseases, including tuberculosis and glioblastoma [PMC3189221]'>PMC3189221], [PMC4673232]. In tuberculosis research, hsa-mir-451, along with other microRNAs, demonstrated increased expression in patients with active tuberculosis compared to those without active disease [PMC3189221]. This differential expression suggests that hsa-mir-451 may serve as a biomarker for detecting active tuberculosis [PMC3189221]. In quantitative PCR assays, hsa-mir-451 has been utilized as an inter-plate calibrator (IPC) in replicates QG1 and QB1 to ensure the consistency and accuracy of results across different plates [PMC7893782]. Additionally, studies have shown that hsa-mir-451 is up-regulated in glioblastoma tissues relative to normal brain tissues, indicating its involvement in cancer pathogenesis and its potential as a diagnostic or prognostic marker [PMC4673232].

Literature search

287 open access papers mention hsa-mir-451a
(1370 sentences)

Sequence

1250752 reads, 5013 reads per million, 125 experiments

cuugggaauggcaaggAAACCGUUACCAUUACUGAGUUuaguaaugguaaugguucucuugcuauacccaga
.(((((.(((((((((.(((((((((((((((((....))))))))))))))))).))))))))).))))).

Structure

c     a         A                 A 
 uuggg auggcaagg AACCGUUACCAUUACUG G
 ||||| ||||||||| |||||||||||||||||  
 gaccc uaucguucu uugguaaugguaaugau U
a     a         c                 U 

Annotation confidence Not enough data

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr17: 28861369-28861440 [-]

Clustered miRNAs

3 other miRNAs are < 10 kb from hsa-mir-451a

Disease association

hsa-mir-451a is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-451a is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-451a is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-451a

• Accession: MIMAT0001631
• Description: Homo sapiens hsa-miR-451a mature miRNA
• Sequence: 17 - AAACCGUUACCAUUACUGAGUU - 38
• Evidence: experimental ; cloned [1-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


3. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267