miRBase entry: hsa-mir-451a

Stem-loop hsa-mir-451a


Accession
MI0001729
Symbol
HGNC: MIR451A
Description
Homo sapiens hsa-mir-451a precursor miRNA mir-451
Gene
family?
RF00722; mir-451

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-451 is a microRNA that has been identified as a significant biomarker in various diseases, including tuberculosis and glioblastoma [PMC3189221]'>PMC3189221], [PMC4673232]. In tuberculosis research, hsa-mir-451, along with other microRNAs, demonstrated increased expression in patients with active tuberculosis compared to those without active disease [PMC3189221]. This differential expression suggests that hsa-mir-451 may serve as a biomarker for detecting active tuberculosis [PMC3189221]. In quantitative PCR assays, hsa-mir-451 has been utilized as an inter-plate calibrator (IPC) in replicates QG1 and QB1 to ensure the consistency and accuracy of results across different plates [PMC7893782]. Additionally, studies have shown that hsa-mir-451 is up-regulated in glioblastoma tissues relative to normal brain tissues, indicating its involvement in cancer pathogenesis and its potential as a diagnostic or prognostic marker [PMC4673232].

Literature search
287 open access papers mention hsa-mir-451a
(1370 sentences)

Sequence

1250752 reads, 5013 reads per million, 125 experiments
cuugggaauggcaaggAAACCGUUACCAUUACUGAGUUuaguaaugguaaugguucucuugcuauacccaga
.(((((.(((((((((.(((((((((((((((((....))))))))))))))))).))))))))).))))).

Structure
c     a         A                 A 
 uuggg auggcaagg AACCGUUACCAUUACUG G
 ||||| ||||||||| |||||||||||||||||  
 gaccc uaucguucu uugguaaugguaaugau U
a     a         c                 U 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr17: 28861369-28861440 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from hsa-mir-451a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-451a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-451a is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-451a is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-451a

Accession MIMAT0001631
Description Homo sapiens hsa-miR-451a mature miRNA
Sequence 17 - AAACCGUUACCAUUACUGAGUU - 38
Evidence experimental
cloned [1-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267