miRBase entry: hsa-mir-449a

Stem-loop hsa-mir-449a


Accession
MI0001648
Symbol
HGNC: MIR449A
Description
Homo sapiens hsa-mir-449a precursor miRNA mir-449
Gene
family?
RF00711; mir-449

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR449A is identified as an endogenous regulator of MET-mediated epithelial-mesenchymal transition (EMT), alongside other regulators such as miR-148a and SENP1 [PMC5643285]. This small RNA is also implicated in the cellular response to hypoxia/reoxygenation (H/R) injury in H9C2 cells, with studies suggesting a functional link between MIR449A and the nuclear receptor subfamily 4 group A member 2 (NR4A2) [PMC8406901]. Additionally, MIR449A is listed among the genes encoding small RNAs in Emca3, which also includes miR449c and miR582 [PMC4132170].

Literature search
129 open access papers mention hsa-mir-449a
(1256 sentences)

Sequence

3955 reads, 127 reads per million, 72 experiments
cugugugugaugagcUGGCAGUGUAUUGUUAGCUGGUugaauaugugaauggcaucggcuaacaugcaacugcugucuuauugcauauaca
.(((((((((((((.(((((((((((.((((((((((.(..(((....))).))))))))))))))).))))))).)))))))))))))..

Structure
-c             c       -    U          u aa   g 
  ugugugugaugag UGGCAGU GUAU GUUAGCUGGU g  uau u
  ||||||||||||| ||||||| |||| |||||||||| |  |||  
  auauacguuauuc gucguca cgua caaucggcua c  gua g
ac             u       a    -          - -g   a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025).

Genome context
chr5: 55170532-55170622 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-449a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-449a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-449a is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-449a is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-449a

Accession MIMAT0001541
Description Homo sapiens hsa-miR-449a mature miRNA
Sequence 16 - UGGCAGUGUAUUGUUAGCUGGU - 37
Evidence experimental
cloned [1-2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15735639
    Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals
    "Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M"
    "Nature (2005) 434:338-345