MIR425 is a differentially expressed microRNA (miRNA) that has been studied in various biological contexts, including cancer and heart disease. In a study focusing on testicular development, MIR425 was among nine miRNAs selected for validation by RT-qPCR in calf and bull testes [PMC9777600]. It has been implicated in breast cancer, where it was found to be generally downregulated in serum samples [PMC9967215], and it is recognized as a regulator of tumorigenesis [PMC5361868]. MIR425 has also been associated with the regulation of the ubiquitin-like protein UBQLN1, although overexpression experiments did not show an effect on UBQLN1 levels [PMC5361868]. In genetic studies involving mice, homozygosity for a MIR425 deletion was found to be lethal, suggesting an essential role for this miRNA in development or survival [PMC8520725]. Furthermore, MIR425 is expressed in cumulus cells (CCs) and has been implicated as a potential biomarker for various cancers including cervical cancer and pancreatic ductal adenocarcinoma (PDAC) [PMC8316837; PMC9599289].. It also plays a role in the regulation of cardiac gene expression and may serve as an early biomarker for heart conditions such as hypertrophic cardiomyopathy and heart failure [PMC9897690; PMC8773242].. Lastly, MIR425 is considered among potential endogenous controls for gene expression studies involving whole blood samples due to its stable expression levels [PMC6172720].
c u AAU U C UUGA gcacc gaaag gc uugg GACACGA CA UCCCG gugg c ||||| || |||| ||||||| || ||||| |||| cuuuc cg gaCC CUGUGCU GU AGGGC UAcc g u u CGC - A ---- gaaga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003393 |
Description | Homo sapiens hsa-miR-425-5p mature miRNA |
Sequence | 14 - AAUGACACGAUCACUCCCGUUGA - 36 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0001343 |
Description | Homo sapiens hsa-miR-425-3p mature miRNA |
Sequence | 55 - AUCGGGAAUGUCGUGUCCGCCC - 76 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|