MIR423 is a microRNA, a small non-coding RNA molecule, which is involved in the regulation of gene expression [PMC7463887]. It was not found to be modulated by genotypes at single nucleotide polymorphisms (SNPs) in a study comparing its expression in leukoplakia tissues to control tissues [PMC4035900]. However, its expression was significantly different when leukoplakia tissues were compared with control tissues, suggesting a potential role in the pathogenesis of this condition [PMC4035900]. Additionally, MIR423 was included in a panel of 16 candidate microRNAs that were previously reported to be altered in the plasma/serum of diabetic patients [PMC7463887]. This panel was analyzed to assess the potential involvement of these microRNAs in diabetic retinopathy among type 2 diabetes (T2D) patients with varying degrees of retinopathy and healthy subjects [PMC7463887]. The study aimed to understand better the molecular mechanisms underlying diabetic complications and potentially identify biomarkers for disease progression and prognosis [PMC7463887].
-----auaa u -AG G A cua aggaagu aggcUGAGGGGC AGA CGAG CUUUu u ||||||| |||||||||||| ||| |||| ||||| u uccuucg ucUGACUCCCCG UCU GCUC GAaaa u cgcgcccaa u GAG G - ccu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004748 |
Description | Homo sapiens hsa-miR-423-5p mature miRNA |
Sequence | 17 - UGAGGGGCAGAGAGCGAGACUUU - 39 |
Evidence |
experimental
cloned [2-4], Northern [4], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0001340 |
Description | Homo sapiens hsa-miR-423-3p mature miRNA |
Sequence | 53 - AGCUCGGUCUGAGGCCCCUCAGU - 75 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|