Stem-loop hsa-mir-196b

Accession

MI0001150

Symbol

HGNC: MIR196B

Description

Homo sapiens hsa-mir-196b precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR196B, a microRNA, was chosen for detailed examination in the context of colorectal cancer due to its potential role in gene regulation [PMC4413621]. It shares a targeting relationship with MIR196A, both of which influence the gene HOXA5 [PMC3742271]. To elucidate the spectrum of MIR196B's target genes, researchers employed mRNA microarray analysis coupled with bioinformatics tools [PMC4413621]. Additionally, the study explored MIR196B's regulatory impact on both mRNA and protein levels of FAS in SW480 colorectal cancer cells [PMC4413621].

Literature search

163 open access papers mention hsa-mir-196b
(815 sentences)

Sequence

320705 reads, 1494 reads per million, 147 experiments

acuggucggugauuUAGGUAGUUUCCUGUUGUUGGGauccaccuuucucUCGACAGCACGACACUGCCUUCauuacuucaguug
(((((..((((((..(((((((.((.(((((((((((..........))))))))))).)).)))))))..)))))))))))..

Structure

--     uc      uU       U  C           ucca 
  acugg  ggugau  AGGUAGU UC UGUUGUUGGGa    c
  |||||  ||||||  ||||||| || |||||||||||     
  ugacu  ucauua  UCCGUCA AG ACGACAGCUcu    c
gu     --      CU       C  C           cuuu 

Annotation confidence High

Comments

miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr7: 27169480-27169563 [-]

Disease association

hsa-mir-196b is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-196b-5p

• Accession: MIMAT0001080
• Description: Homo sapiens hsa-miR-196b-5p mature miRNA
• Sequence: 15 - UAGGUAGUUUCCUGUUGUUGGG - 36
• Evidence: experimental ; cloned [2-3]

Mature hsa-miR-196b-3p

• Accession: MIMAT0009201
• Description: Homo sapiens hsa-miR-196b-3p mature miRNA
• Sequence: 50 - UCGACAGCACGACACUGCCUUC - 71
• Evidence: experimental ; 454 [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 19144710
   Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
   "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
   "J Virol (2009) 83:3333-3341


4. PubMed ID: 15105502
   MicroRNA-directed cleavage of HOXB8 mRNA
   "Yekta S, Shih IH, Bartel DP"
   "Science (2004) 304:594-596