Stem-loop ath-MIR399d

Accession

MI0001023

Description

Arabidopsis thaliana ath-MIR399d precursor miRNA

Literature search

37 open access papers mention ath-MIR399d
(207 sentences)

Sequence

gguuggauuacugggcgaauacuccuauggcagaucgcauuggcuagauaugcaaguaaaaugcuucucUGCCAAAGGAGAUUUGCCCCGcaauucaucc
((.((((((.(.((((((((.(((((.(((((((..(((((.(((.(.....).)))..)))))...))))))).))))))))))))).).)))))).))

Structure

  u      a u        a     a       -uc     -g   a a 
gg uggauu c gggcgaau cuccu uggcaga   gcauu  gcu g u
|| |||||| | |||||||| ||||| |||||||   |||||  ||| | a
cc acuuaa G CCCGUUUA GAGGA ACCGUcu   cguaa  uga c u
  u      c C        -     A       cuu     aa   a g 

Annotation confidence Low

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

chr2: 14442978-14443077 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from ath-MIR399d

Mature ath-miR399d

• Accession: MIMAT0000954
• Description: Arabidopsis thaliana ath-miR399d mature miRNA
• Sequence: 70 - UGCCAAAGGAGAUUUGCCCCG - 90
• Evidence: experimental ; PCR [1], 5'RACE [2], 454 [3-4], MPSS [3], Illumina [5]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799