Stem-loop ath-MIR399b

Accession

MI0001021

Description

Arabidopsis thaliana ath-MIR399b precursor miRNA

Literature search

34 open access papers mention ath-MIR399b
(187 sentences)

Sequence

ucacuaguuuuagggcgccucuccauuggcagguccuuuacuuccaaauauacacauacauauaugaauaucgaaaauuuccgaugaucgauuuauaaaugaccUGCCAAAGGAGAGUUGCCCUGaaacugguuc
..(((((((((((((((.((((((.((((((((((.((((.......(((((........)))))((.(((((........))))).))......)))).)))))))))).)))))).)))))))))))))))..

Structure

uc               c      a          c    cuuccaaauauacacauacauauau  a     aaa 
  acuaguuuuagggcg cucucc uuggcagguc uuua                         ga uaucg   a
  ||||||||||||||| |||||| |||||||||| ||||                         || |||||    
  uggucaaaGUCCCGU GAGAGG AACCGUccag aaau                         cu guagc   u
cu               U      A          u    -------------------auuuag  a     cuu 

Annotation confidence Low

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

chr1: 23345377-23345511 [-]

Mature ath-miR399b

• Accession: MIMAT0000952
• Description: Arabidopsis thaliana ath-miR399b mature miRNA
• Sequence: 105 - UGCCAAAGGAGAGUUGCCCUG - 125
• Evidence: experimental ; PCR [1], cloned [2-3], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


6. PubMed ID: 15258262
   Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
   "Sunkar R, Zhu JK"
   "Plant Cell (2004) 16:2001-2019