MIR345 is a microRNA implicated in various cancer-related processes, including cell proliferation and invasion, particularly in colorectal cancer, where its expression is down-regulated due to methylation sensitivity [PMC3383700]. It is produced following signal transduction initiated by the binding of SDF1 to CXCR4 in astrocytes [PMC7795138]. In pancreatic cancer tissues, MIR345 is one of the miRNAs found to be differentially expressed, suggesting a potential role for miRNA-based therapies [PMC7457762]. Additionally, MIR345 forms part of circRNA-miRNA-mRNA networks that may be relevant for understanding molecular interactions in cancer [PMC7312917]. Its expression is also reduced in colorectal cancer due to the hypermethylation of its promoter [PMC8910953], and it has been identified as a low-level expressed miRNA in tumor tissues or cells [PMC7797122], as well as being dose-dependently reduced following endothelial injury by oxLDL [PMC9199460]. In network analyses related to gastric cancer survival, MIR345 was identified as one of the significant factors [PMC5856436], and it has been recognized as a metastasis-suppressive gene alongside other protein-coding genes and microRNAs [PMC8484294]. Overexpression of MIR345 has been associated with malignant transformation and increased lesion severity during progression from leukoplakia to invasive oral squamous cell carcinoma (OSCC) [PMC3292026; PMC5596676]..
---------acc u G U A C gau caaaccc aggucu C GACUCCU GU CAGGGCUCgu g ||||||| |||||| | ||||||| || |||||||||| guuuggg uccgGA G CUGGGGA CA GUCCCGggug g cgacagcuauaa - G U G A guc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000772 |
Description | Homo sapiens hsa-miR-345-5p mature miRNA |
Sequence | 18 - GCUGACUCCUAGUCCAGGGCUC - 39 |
Evidence |
experimental
cloned [3-4], Northern [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022698 |
Description | Homo sapiens hsa-miR-345-3p mature miRNA |
Sequence | 54 - GCCCUGAACGAGGGGUCUGGAG - 75 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|