miRBase entry: hsa-mir-133b

Stem-loop hsa-mir-133b


Accession
MI0000822
Symbol
HGNC: MIR133B
Description
Homo sapiens hsa-mir-133b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR133B is a microRNA implicated in various biological processes and has been observed to interact with other RNA molecules and to play a role in disease contexts [PMC7068214]. Specifically, lncRNA LOC400043 has been found to interact with MIR133B, leading to the downregulation of its expression [PMC7068214]. This microRNA has also been utilized in research as a means to attenuate infection by inserting its target sites into the genome of the influenza A virus, demonstrating effective attenuation in murine myocyte-like cells and cardiac tissue [PMC9094651]. Beyond its application in virology, MIR133B has been profiled by researchers studying Parkinson's disease (PD), indicating its potential relevance in the pathology of neurodegenerative diseases [PMC3540391]. The therapeutic potential of MIR133B has been explored through intranasal (IN) delivery, which was assessed for its impact on functional recovery post-spinal cord injury (SCI) using two behavioral tasks: GSM for forelimb grip strength evaluation and a hanging task for forelimb grasp assessment during an 8-week testing time post-SCI [PMC10047048].

Literature search
328 open access papers mention hsa-mir-133b
(1862 sentences)

Sequence

12245 reads, 266 reads per million, 107 experiments
ccucagaagaaagaugcccccugcucuggcuggucaaacggaaccaaguccgucuuccugagaggUUUGGUCCCCUUCAACCAGCUAcagcagggcuggcaaugcccaguccuuggaga
..............(((((((((((.((((((((..((.((.((((((.((.((((...)))))))))))).)).))..)))))))).)))))))..))))....(((.....)))...

Structure
----ccucagaagaaaga    --       c        ca  c  a      u  g    c 
                  ugcc  cccugcu uggcuggu  aa gg accaag cc ucuu  
                  ||||  ||||||| ||||||||  || || |||||| || |||| c
                  acgg  gggacga AUCGACCA  UU CC UGGUUU gg agag  
agagguuccugacccgua    uc       c        AC  C  C      -  -    u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1], and later verified in human [2].

Genome context
chr6: 52148923-52149041 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-133b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-133b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-133b

Accession MIMAT0000770
Description Homo sapiens hsa-miR-133b mature miRNA
Sequence 66 - UUUGGUCCCCUUCAACCAGCUA - 87
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540