Stem-loop hsa-mir-335

Accession

MI0000816

Symbol

HGNC: MIR335

Description

Homo sapiens hsa-mir-335 precursor miRNA mir-335

Gene
family

RF00766; mir-335

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR335 is a microRNA that is deregulated in adipose-derived stem cells (ASCs) and is associated with impaired lamin A association with the T locus in mutant induced pluripotent stem (iPS) cells [PMC6053905]. In addition, MIR335 is found in extracellular vesicles (EVs) and targets genes involved in "Ras protein signal transduction" and "Actin/microtubule cytoskeleton organization" [PMC7287171]. MIR335 is a microRNA that plays a role in the regulation of gene expression. In ASCs, its deregulation correlates with impaired lamin A association with the T locus, suggesting its involvement in cellular processes related to adipose tissue [PMC6053905]. Furthermore, MIR335 is found in EVs and targets genes involved in important cellular pathways such as Ras protein signal transduction and Actin/microtubule cytoskeleton organization [PMC7287171]. This suggests that MIR335 may have a role in regulating these pathways through its interaction with target genes. Overall, these findings highlight the importance of MIR335 in cellular processes related to adipose tissue regulation as well as its potential involvement in important signaling pathways. Further research on the specific mechanisms by which MIR335 regulates gene expression and its functional implications could provide valuable insights into the understanding of adipose tissue biology and related diseases.

Literature search

169 open access papers mention hsa-mir-335
(872 sentences)

Sequence

142960 reads, 4193 reads per million, 137 experiments

uguuuugagcgggggUCAAGAGCAAUAACGAAAAAUGUuugucauaaaccgUUUUUCAUUAUUGCUCCUGACCuccucucauuugcuauauuca
.....((((.((((((((.(((((((((.((((((((.((......)).)))))))).))))))))).)))))))).)))).............

Structure

--------uguuu    c        A         C        U  gu 
             ugag gggggUCA GAGCAAUAA GAAAAAUG uu  c
             |||| |||||||| ||||||||| |||||||| ||   
             acuc ccuCCAGU CUCGUUAUU CUUUUUgc aa  a
acuuauaucguuu    u        C         A        c  au 

Annotation confidence High

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context

chr7: 130496111-130496204 [+]

Disease association

hsa-mir-335 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-335-5p

• Accession: MIMAT0000765
• Description: Homo sapiens hsa-miR-335-5p mature miRNA
• Sequence: 16 - UCAAGAGCAAUAACGAAAAAUGU - 38
• Evidence: experimental ; cloned [3-4]

Mature hsa-miR-335-3p

• Accession: MIMAT0004703
• Description: Homo sapiens hsa-miR-335-3p mature miRNA
• Sequence: 52 - UUUUUCAUUAUUGCUCCUGACC - 73
• Evidence: experimental ; cloned [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


4. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365