MIR331 is a microRNA implicated in various biological processes and diseases, including cancer and cardiovascular conditions [PMC5447065]. It is suggested to play a role in chronic lymphocytic leukemia (CLL) by potentially targeting SOCS1, a gene whose reduced expression is associated with cancer cell survival and proliferation [PMC6183594]. MIR331 is also differentially expressed in osteosarcoma (OS), correlating with patient survival rates, and has been identified as one of the m6A-related ncRNAs significantly associated with overall survival [PMC8648947]. In the context of gene expression regulation, MIR331's function can be inhibited by G-quadruplex structures that prevent miRNA binding to its target mRNA [PMC5513062]. Additionally, MIR331 has been linked to high-density lipoprotein cholesterol (HDL-c) levels through genome-wide association studies (GWAS), suggesting its involvement in lipid metabolism [PMC6851116]. It also appears to be part of the molecular mechanisms through which osthole alleviates neuropathic pain by interacting with genes involved in metabolic pathways and gut microbiota modulation [PMC8860327]. Furthermore, MIR331 has been identified as interacting with various genes on ovine chromosome 3 (OAR3), which may have implications for genetic studies in sheep [PMC8355708]. Lastly, it interacts with numerous protein-coding genes and non-coding RNAs within the cell's regulatory networks, highlighting its multifaceted role within cellular processes [PMC9730017][PMC5458088][PMC6732937][PMC8122139][PMC6824518][PMC3956820][PMC5320387][PMC8795515[PMC5458088][PMC6732937][PMC8122139][PMC6824518][PMC3956820][PMC5320387][PMC8795515].
gaguuugguuuu u U U AUC agau guuuggguu guuCUAGG AUGG CCCAGGG Cc c ||||||||| |||||||| |||| ||||||| || a cgaauccaa cAAGAUCC UAUC GGGUCCC Gg a ----------cu c - C --C acca
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0004700 |
Description | Homo sapiens hsa-miR-331-5p mature miRNA |
Sequence | 26 - CUAGGUAUGGUCCCAGGGAUCC - 47 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000760 |
Description | Homo sapiens hsa-miR-331-3p mature miRNA |
Sequence | 61 - GCCCCUGGGCCUAUCCUAGAA - 81 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|