miRBase entry: hsa-mir-331

Stem-loop hsa-mir-331


Accession
MI0000812
Symbol
HGNC: MIR331
Description
Homo sapiens hsa-mir-331 precursor miRNA mir-331
Gene
family?
RF00769; mir-331

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR331 is a microRNA implicated in various biological processes and diseases, including cancer and cardiovascular conditions [PMC5447065]. It is suggested to play a role in chronic lymphocytic leukemia (CLL) by potentially targeting SOCS1, a gene whose reduced expression is associated with cancer cell survival and proliferation [PMC6183594]. MIR331 is also differentially expressed in osteosarcoma (OS), correlating with patient survival rates, and has been identified as one of the m6A-related ncRNAs significantly associated with overall survival [PMC8648947]. In the context of gene expression regulation, MIR331's function can be inhibited by G-quadruplex structures that prevent miRNA binding to its target mRNA [PMC5513062]. Additionally, MIR331 has been linked to high-density lipoprotein cholesterol (HDL-c) levels through genome-wide association studies (GWAS), suggesting its involvement in lipid metabolism [PMC6851116]. It also appears to be part of the molecular mechanisms through which osthole alleviates neuropathic pain by interacting with genes involved in metabolic pathways and gut microbiota modulation [PMC8860327]. Furthermore, MIR331 has been identified as interacting with various genes on ovine chromosome 3 (OAR3), which may have implications for genetic studies in sheep [PMC8355708]. Lastly, it interacts with numerous protein-coding genes and non-coding RNAs within the cell's regulatory networks, highlighting its multifaceted role within cellular processes [PMC9730017][PMC5458088][PMC6732937][PMC8122139][PMC6824518][PMC3956820][PMC5320387][PMC8795515[PMC5458088][PMC6732937][PMC8122139][PMC6824518][PMC3956820][PMC5320387][PMC8795515].

Literature search
78 open access papers mention hsa-mir-331
(231 sentences)

Sequence

104961 reads, 309 reads per million, 126 experiments
gaguuugguuuuguuuggguuuguuCUAGGUAUGGUCCCAGGGAUCCcagaucaaaccagGCCCCUGGGCCUAUCCUAGAAccaaccuaagcuc
............(((((((((.((((((((.((((.(((((((...((...........)).))))))).)))))))))))).)))))))))..

Structure
gaguuugguuuu         u        U    U       AUC  agau 
            guuuggguu guuCUAGG AUGG CCCAGGG   Cc    c
            ||||||||| |||||||| |||| |||||||   ||    a
            cgaauccaa cAAGAUCC UAUC GGGUCCC   Gg    a
----------cu         c        -    C       --C  acca 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
chr12: 95308420-95308513 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-331
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-331-5p

Accession MIMAT0004700
Description Homo sapiens hsa-miR-331-5p mature miRNA
Sequence 26 - CUAGGUAUGGUCCCAGGGAUCC - 47
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-331-3p

Accession MIMAT0000760
Description Homo sapiens hsa-miR-331-3p mature miRNA
Sequence 61 - GCCCCUGGGCCUAUCCUAGAA - 81
Evidence experimental
cloned [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365