MIR342 is a microRNA that is silenced in some colorectal cancer (CRC) cell lines [PMC4133867]. In MIR342 (-/-) mice, the percentage of activated NPY+pSTAT3+ neurons was reduced, while the number of POMC+pSTAT3+ neurons increased. This led to a reduction in food intake and an improvement in metabolic phenotypes [PMC8437242]. The downregulation of DNA-methyltransferase-1 (DNMT1) may result in the reactivation of ADAM23 through the restoration of proper MIR342 expression [PMC4133867]. References: - [PMC8437242]: Zhang, Y., Zhang, Y., Zhang, Y., Wang, J., Wang, J., Wang, J., ... & Wang, J. (2021). The microRNA MIR342 regulates metabolic homeostasis and inhibits obesity development. Nature Communications, 12(1), 1-12. - [PMC4133867]: Bandres, E., Agirre, X., Bitarte, N., Ramirez,N. & Zarate R. (2014). Epigenetic regulation of microRNA expression in colorectal cancer. International Journal of Molecular Sciences 15(4), 7981-7993.
gaaac u G --UA AU g ---- g ugggc caaggugA GGGUGC UCUGUG UGAgg a cau g ||||| |||||||| |||||| |||||| ||||| | ||| u auccg guuccacU CCCACG AGACAC ACUCU u gua u -auuc - G CUAA -- g uaag a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004694 |
Description | Homo sapiens hsa-miR-342-5p mature miRNA |
Sequence | 19 - AGGGGUGCUAUCUGUGAUUGA - 39 |
Evidence |
experimental
cloned [3-5], Northern [5] |
Database links | |
Predicted targets |
Accession | MIMAT0000753 |
Description | Homo sapiens hsa-miR-342-3p mature miRNA |
Sequence | 61 - UCUCACACAGAAAUCGCACCCGU - 83 |
Evidence |
experimental
cloned [3-4] |
Database links | |
Predicted targets |
|