MIR340 is a host microRNA implicated in the regulation of antiviral responses, specifically targeting the antiviral factors RIG-I and OAS2, which are crucial in the host's defense against influenza virus infection [PMC6370596]. The study's findings suggest that MIR340 may play a role in modulating immunity, as its inhibition could potentially enhance the immune response against influenza by reducing the suppression of these key antiviral proteins [PMC6370596]. The identification of MIR340 target sites within the 3สน UTR of RIG-I at positions 1,657 and 1,809 supports the strategy of targeting host miRNAs as a novel therapeutic approach to combat influenza virus infection [PMC6370596]. This approach is consistent with previous reports that miRNA-dependent strategies have been developed for viral infections and that modulating miRNA activity can have a significant impact on viral resistance, as seen with miR144-deficient mice and their resistance to influenza virus [PMC6370596].
--uu u a -CAA U g ug guacc ggugug UUAUAAAG UGAGAC GAUU ucaua u ||||| |||||| |||||||| |||||| |||| ||||| c uaugg ccauac GAUAUUUC ACUCUG CUag ggugu g auuc u C AUUG C - uu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004692 |
Description | Homo sapiens hsa-miR-340-5p mature miRNA |
Sequence | 16 - UUAUAAAGCAAUGAGACUGAUU - 37 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000750 |
Description | Homo sapiens hsa-miR-340-3p mature miRNA |
Sequence | 58 - UCCGUCUCAGUUACUUUAUAGC - 79 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|