miRBase entry: hsa-mir-383

Stem-loop hsa-mir-383


Accession
MI0000791
Symbol
HGNC: MIR383
Description
Homo sapiens hsa-mir-383 precursor miRNA mir-383
Gene
family?
RF00715; mir-383

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR383 is a microRNA that has been identified as a potential biomarker for various diseases, including bovine mastitis, where it exhibits high sensitivity and specificity for differentiating between mastitis-positive and normal milk [PMC8532728]. In studies involving HepG2 and SMMC-7721 cells, MIR383 mimics were used to investigate its role in cellular processes such as glycolysis in hepatocellular carcinoma (HCC), where metabolic parameter differences were observed post-transfection [PMC5339660]. Additionally, MIR383 has been correlated with the expression of its target genes in different contexts [PMC3092095]. In the context of diet-induced obesity (DIO) in mice, MIR383 levels were found to be decreased in islets [PMC7236805], while MECP2 has been shown to suppress the maturation of several miRNAs including MIR383 in the hippocampus [PMC6647430]. Furthermore, MIR383 expression patterns have been studied during embryonic stem cell differentiation [PMC4240536], and its association with improved clinical outcomes has been reported in non-small cell lung cancer (NSCLC) patients [PMC5505543]. In cancer research, upregulation of MIR383 is suggested to suppress gastric cancer development by inhibiting cyclin E2 expression [PMC9608775], and it is also implicated as a diagnostic biomarker for head and neck cancers [PMC8446523].

Literature search
31 open access papers mention hsa-mir-383
(290 sentences)

Sequence

3282 reads, 94 reads per million, 34 experiments
cuccucAGAUCAGAAGGUGAUUGUGGCUuuggguggauauuaaucagccACAGCACUGCCUGGUCAGAaagag
(((.((.((((((..((((.((((((((...(((........)))))))))))))))..)))))).))..)))

Structure
   -c  A      AA    A        uug   gga 
cuc  uc GAUCAG  GGUG UUGUGGCU   ggu   u
|||  || ||||||  |||| ||||||||   |||    
gag  AG CUGGUC  UCAC GACAccga   cua   a
   aa  A      CG    -        ---   auu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr8: 14853438-14853510 [-]

Disease association
hsa-mir-383 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-383-5p

Accession MIMAT0000738
Description Homo sapiens hsa-miR-383-5p mature miRNA
Sequence 7 - AGAUCAGAAGGUGAUUGUGGCU - 28
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-383-3p

Accession MIMAT0026485
Description Homo sapiens hsa-miR-383-3p mature miRNA
Sequence 50 - ACAGCACUGCCUGGUCAGA - 68
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45