MIR379 is an imprinted microRNA that is part of the DLK1-DIO3 genomic region and is implicated in various biological processes and diseases [PMC3743905]. It is activated during the epithelial to mesenchymal transition in prostate cancer cells [PMC5195822]. MIR379, along with other miRNAs, forms a cluster that has been associated with sensitivity to certain chemotherapeutic agents in cancer cell lines [PMC9716673]. This miRNA has been shown to maintain stable levels during induced long-term potentiation, suggesting a potential role in synaptic plasticity [PMC7486624]. MIR379 has also been implicated in skeletal muscle differentiation and has been correlated with various lipid levels in early-stage non-alcoholic fatty liver disease (NAFLD) patients, suggesting its potential as a biomarker for early detection of NAFLD [PMC8111742], [PMC9738374]. Furthermore, MIR379 expression levels were found to be significantly higher in patients with early-stage NAFLD compared to controls [PMC9738374]'>PMC9738374], and its serum levels were increased in a Japanese population of NAFLD patients [PMC9738374]. It targets numerous genes involved in different biological processes and diseases such as diabetic nephropathy (DN) and may have therapeutic implications for conditions like obesity and type 2 diabetes when inhibited by specific modalities like GapmeRs [PMC9535382], [PMC8255808].
a A GA - uuau agag UGGU GACUAUG ACGUAGG cg g |||| |||| ||||||| ||||||| || ucUC AUCA CUGGUAC UGUAUcc gu a A C AA a cuuu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000733 |
Description | Homo sapiens hsa-miR-379-5p mature miRNA |
Sequence | 6 - UGGUAGACUAUGGAACGUAGG - 26 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004690 |
Description | Homo sapiens hsa-miR-379-3p mature miRNA |
Sequence | 44 - UAUGUAACAUGGUCCACUAACU - 65 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|