MIR375 is a microRNA specifically expressed in islet cells and is implicated in the differentiation of embryonic stem cells into liver and insulin-secreting cells, suggesting a role in early islet development [PMC4700298]. It has been utilized in an integrated analysis with miR371 to predict the risk of aggressive germ cell malignancies and teratoma in patients with residual disease post-chemotherapy [PMC8575592]. Additionally, MIR375 has been associated with the inhibition of autophagy, which may enhance the chemosensitivity of cancer cells when coupled with WWOX [PMC8939209]. Furthermore, it has been suggested that MIR375 can be down-regulated to potentially improve dendritic cell function by a factor known as PB1 [PMC5360757]. In terms of diagnostic potential, MIR375 is among several miRNAs that may show changes in concentration prior to cardiac troponin I during cardiac events, indicating its potential as an early biomarker [PMC3922900].
c - A CCU C C gac cc cGCG CGAGCC CG ACAAA Cg c || |||| |||||| || ||||| || gg GUGC GCUCGG GC UGUUU gc u c A - CUU U u gag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000728 |
Description | Homo sapiens hsa-miR-375-3p mature miRNA |
Sequence | 40 - UUUGUUCGUUCGGCUCGCGUGA - 61 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0037313 |
Description | Homo sapiens hsa-miR-375-5p mature miRNA |
Sequence | 5 - GCGACGAGCCCCUCGCACAAACC - 27 |
Evidence | not_experimental |
|