MIR302C is one of the upregulated genes associated with the inhibition of EC migration and proliferation in ESRD-hiPSC-ECs [PMC8685359]. However, MIR302C is not expressed in pulmonary cells [PMC4125569]. The pathway of GSEA enrichment includes MIR302C and is associated with various cancer-related processes [PMC9130929]. MIR302C expression is induced by JMJD2 demethylase binding in its promoter region and reduces H3K9me2 methylation [PMC4501658]. PRP-1, a cytostatic peptide, downregulates MIR302C targets, including stemness markers Nanog and c-Myc [PMC4501658]. Overexpression of miR302s, including MIR302C, induces massive apoptosis in cancer cell lines [PMC4400607]. MIR302C is part of the miR-302 family that plays a key role in pluripotency and cell reprogramming [PMC4433211]. It is also downregulated in pancreatic cancer and associated with age-related decline [PMC6154866][PMC6046043[PMC6046043]. Activation of canonical BMP signaling upregulates miR302b and MIR302C expression [PMC4164941]. The miR-302 cluster includes miR-302b, MIR302C, miR-302a, miR- 02d, and miR367 that are highly expressed in embryonic stem cells but decline after differentiation [PMC6722449][PMC7555329].[PMC7555329].\
UU C -G g ccuuugcU AACAUGGGGGUAC UGCU ugu |||||||| ||||||||||||| |||| ||| a ggaGGUGA UUGUACCUUCGUG AUga aca CU A aa a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000716 |
Description | Homo sapiens hsa-miR-302c-5p mature miRNA |
Sequence | 8 - UUUAACAUGGGGGUACCUGCUG - 29 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Accession | MIMAT0000717 |
Description | Homo sapiens hsa-miR-302c-3p mature miRNA |
Sequence | 43 - UAAGUGCUUCCAUGUUUCAGUGG - 65 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|