MIR302B is a member of the miR302 cluster, which is known to play a role in promoting human somatic cell reprogramming [PMC4164941]. In a mouse endothelial cell model, the expression of MIR302B and miR302c was down-regulated by ROCK1 siRNA and ROCK2 siRNA [PMC4164941]. Knockdown of p120 or p120-Kaiso siRNAs in human corneal endothelial cells (HCECs) resulted in increased expression of MIR302B and miR302c [PMC4164941]. Noggin blocked the overexpression of MIR302B and miR302c, as well as the nuclear translocation of ESC markers and positive expression of neural crest markers [PMC4164941]. In HCEC monolayers, reprogramming by canonical BMP signaling was associated with nuclear staining of Oct4, Sox2, and Nanog, as well as up-regulation of MIR302B [PMC4164941]. MIR302B is also upregulated in ESRD-hiPSC-ECs (endothelial cells derived from induced pluripotent stem cells) associated with oxidative stress and inflammation [PMC8685359]. It is highly expressed in human oral fibroblast-induced pluripotent stem cells (hOF-iPSCs) along with other pluripotent markers such as NANOG and OCT4 [PMC4538314]. MIR302B has been shown to induce apoptosis in tumor/cancer cell lines when overexpressed along with other members of the miR-302 cluster such as MIR302A, MIR302C, and MIR302D [PMC4400607]. It has also been implicated in regulating EGFR expression at the translational level in SMMC-7721 cells [PMC3850949]. Overall, MIR302B is a member of the miR302 cluster that plays a role in somatic cell reprogramming, pluripotency, and apoptosis in cancer cells [PMC4164941][PMC8685359][PMC4538314][PMC4400607][PMC3850949[PMC8685359][PMC4538314][PMC4400607][PMC3850949].
gcucc a UU U guga cuuc ACU AACAUGGAAGUGCUU Cu c |||| ||| ||||||||||||||| || u gagG UGA UUGUACCUUCGUGAA ga u ----u A UU U aaau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000714 |
Description | Homo sapiens hsa-miR-302b-5p mature miRNA |
Sequence | 11 - ACUUUAACAUGGAAGUGCUUUC - 32 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Accession | MIMAT0000715 |
Description | Homo sapiens hsa-miR-302b-3p mature miRNA |
Sequence | 47 - UAAGUGCUUCCAUGUUUUAGUAG - 69 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|