miRBase entry: hsa-mir-302b

Stem-loop hsa-mir-302b


Accession
MI0000772
Symbol
HGNC: MIR302B
Description
Homo sapiens hsa-mir-302b precursor miRNA mir-302
Gene
family?
RF00668; mir-302

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR302B is a member of the miR302 cluster of microRNAs, which plays a significant role in promoting human somatic cell reprogramming and is highly expressed in embryonic stem cells [PMC4164941]'>PMC4164941], [PMC6722449]. The expression of MIR302B, along with miR302c, is upregulated in human corneal endothelial cells (HCECs) following the knockdown by p120 siRNA or p120-Kaiso siRNAs [PMC4164941]. This upregulation is associated with the activation of canonical BMP signaling and correlates with nuclear staining of pluripotency markers such as Oct4, Sox2, and Nanog [PMC4164941]. However, MIR302B expression can be inhibited by Noggin and CT-04 as well as by siRNA targeting ROCK1 and ROCK2 [PMC4164941]. In addition to its role in pluripotency, MIR302B has been implicated in various biological processes such as oxidative stress response, inflammation regulation, cell migration and proliferation inhibition in endothelial cells derived from induced pluripotent stem cells (iPSC-ECs) from end-stage renal disease patients [PMC8685359], [PMC5858164]. Furthermore, MIR302B has been shown to target EGFR at the translational level but not at the transcription level in certain cell lines [PMC3850949], indicating its potential involvement in post-transcriptional gene regulation.

Literature search
193 open access papers mention hsa-mir-302b
(1248 sentences)

Sequence

587 reads, 12 reads per million, 16 experiments
gcucccuucaACUUUAACAUGGAAGUGCUUUCugugacuuuaaaagUAAGUGCUUCCAUGUUUUAGUAGgagu
.....((((.(((..(((((((((((((((.((...........)).)))))))))))))))..))).)))).

Structure
gcucc    a   UU               U  guga 
     cuuc ACU  AACAUGGAAGUGCUU Cu    c
     |||| |||  ||||||||||||||| ||    u
     gagG UGA  UUGUACCUUCGUGAA ga    u
----u    A   UU               U  aaau 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 112648485-112648557 [-]
Clustered miRNAs
4 other miRNAs are < 10 kb from hsa-mir-302b
Name Accession Chromosome Start End Strand Confidence



Biological pathways
hsa-mir-302b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-302b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-302b-5p

Accession MIMAT0000714
Description Homo sapiens hsa-miR-302b-5p mature miRNA
Sequence 11 - ACUUUAACAUGGAAGUGCUUUC - 32
Evidence experimental
cloned [1-2], Northern [1]

Mature hsa-miR-302b-3p

Accession MIMAT0000715
Description Homo sapiens hsa-miR-302b-3p mature miRNA
Sequence 47 - UAAGUGCUUCCAUGUUUUAGUAG - 69
Evidence experimental
cloned [1-2], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414