MIR301A is a microRNA that is regulated by glycine through NMDA receptor-dependent signaling [PMC4880874]. The expression of MIR301A was tested in FXR1-depleted cells to determine if it is regulated by FXR1 [PMC6986764]. In addition to miR128, miR152, miR130a, and MIR301A, other miRNAs such as miR-130b and miR-26b-5p were found to be downregulated in the serum of high-risk women compared to low-risk women and predicted to regulate CSF-1 [PMC6411608]. In some tetrapods and teleosts, MIR301A is located in the first intron of ska2 but is missing in seadragons [PMC9245644]. The role of MIR301A in cancer cell proliferation, migration, invasion, and apoptosis regulation is still under debate [PMC6912041]. IL-6 was found to be overexpressed in serum and CRC tissues and correlated with CRC tumor stage, invasion depth, lymph node metastasis, CEA levels, relapse risk, overall survival (OS), and disease-free survival (DFS) [PMC8040557][PMC6411608][PMC9245644][PMC6912041[PMC6411608][PMC9245644][PMC6912041][PMC6411608][PMC9245644][PMID'>PMC8040557][PMC6411608][PMC9245644][PMC6912041][PMC6411608][PMC9245644][PMID[PMC6411608][PMC9245644][PMC6912041][PMC6411608][PMC9245644][PMID: 10.1002/ijc.33410]. IL-1β was shown to promote colon cancer cell proliferation through the NF-κB pathway by increasing the expression of miR-181a and MIR301A [PMID: 10.1002/ijc.33410] [PMID: 10.1002/ijc.33410] . IL-6 production induced by IL-1β from neutrophils in the intestinal mucosa promoted tumor initiation and progression [PMC8040557][PMC6411608][PMC9245644][PMC6912041]. PNPT1-mediated degradation of MIR301A was found to be blocked by FXR1, and in the absence of FXR1, PNPT1 was recruited to degrade MIR301A-3p [PMC6986764].
a aa a C ---U A - acu cugcu cg auGCU UGAC UUAUUGCACU CU gu u ||||| || ||||| |||| |||||||||| || || gacga gu uaCGA ACUG GAUAACGUGA ga cg u g aa c A UUAU C u aca
Accession | MIMAT0000688 |
Description | Homo sapiens hsa-miR-301a-3p mature miRNA |
Sequence | 51 - CAGUGCAAUAGUAUUGUCAAAGC - 73 |
Evidence |
experimental
cloned [2,4], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022696 |
Description | Homo sapiens hsa-miR-301a-5p mature miRNA |
Sequence | 14 - GCUCUGACUUUAUUGCACUACU - 35 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|