miRBase entry: hsa-mir-34c

Stem-loop hsa-mir-34c


Accession
MI0000743
Symbol
HGNC: MIR34C
Description
Homo sapiens hsa-mir-34c precursor miRNA mir-34
Gene
family?
RF00456; mir-34

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR34C is a microRNA implicated in the regulation of gene expression, including the gene Bcl-2, which is known to play a role in cell survival and apoptosis [PMC4067617]. In a study where embryos were treated with VFm34cI, an inhibitor of MIR34C, an increase in Bcl-2 expression was observed on the first day post-treatment [PMC4067617]. This suggests that the VisuFect-mediated delivery of MIR34C inhibitor was successful and that the inhibitor was functioning effectively within the zygotes [PMC4067617]. Additionally, to assess the impact of Zika virus infection on MIR34C expression levels, real-time PCR assays were conducted on three different clones [PMC6425033]. This analysis confirmed that Zika infection induces changes in MIR34C expression [PMC6425033], which could have implications for understanding how Zika virus affects embryonic development and gene regulation.

Literature search
448 open access papers mention hsa-mir-34c
(2624 sentences)

Sequence

171442 reads, 456 reads per million, 102 experiments
agucuaguuacuAGGCAGUGUAGUUAGCUGAUUGCuaauaguaccAAUCACUAACCACACGGCCAGGuaaaaagauu
.((((..(((((.(((.((((.(((((.((((((.((....)).))))))))))).)))).))).)))))..)))).

Structure
a    ag     A   A    A     C      C  a 
 gucu  uuacu GGC GUGU GUUAG UGAUUG ua u
 ||||  ||||| ||| |||| ||||| |||||| ||  
 uaga  aauGG CCG CACA CAAUC ACUAAc au a
u    aa     A   G    C     -      c  g 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences.

Genome context
chr11: 111513439-111513515 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-34c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-34c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-34c is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-34c is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-34c-5p

Accession MIMAT0000686
Description Homo sapiens hsa-miR-34c-5p mature miRNA
Sequence 13 - AGGCAGUGUAGUUAGCUGAUUGC - 35
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-34c-3p

Accession MIMAT0004677
Description Homo sapiens hsa-miR-34c-3p mature miRNA
Sequence 46 - AAUCACUAACCACACGGCCAGG - 67
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358