MIR219A2 is a microRNA implicated in the differentiation of oligodendrocytes and the process of remyelination, and it has been observed to be downregulated in Alzheimer's disease (AD) patients' brains [PMC9822908]. In the context of AD, a study has shown that oligodendrocytes express fewer transcripts of genes like MIR219A2, which is essential for the maturation of myelin-forming cells [PMC6980793]. This downregulation was identified as a characteristic feature distinguishing clusters Oligo1 and Oligo2 in gene expression profiles [PMC6980793]. Furthermore, MIR219A2's reduced expression correlates with a decrease in genes that are crucial for myelination processes, such as those involved in axonal guidance and actin cytoskeleton rearrangement [PMC6980793]. The study's heatmap analysis specifically highlighted MIR219A2 among genes with significantly reduced expression that are typically involved in promoting myelination by aiding the differentiation from precursor cells to mature myelin-forming cells [PMC6980793]. In addition to AD, MIR219A2 upregulation has been noted relative to other subtypes in amyotrophic lateral sclerosis with transactive response DNA-binding protein 43 kDa pathology (ALS-TD), suggesting its role in transcriptional and translational dysregulation within this disease context as well [PMC9822908].
a a c U U AA uac a u cuc ggggcuu gccac GAU GUCCA CGCAAUUCUug g guc ||| ||||||| ||||| ||| ||||| ||||||||||| | ||| g ggg ccucgag cggUG CUA CAGGU GUGUUAAGAgc c cgg - - u U - CG caa - c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000276 |
Description | Homo sapiens hsa-miR-219a-5p mature miRNA |
Sequence | 19 - UGAUUGUCCAAACGCAAUUCU - 39 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0004675 |
Description | Homo sapiens hsa-miR-219a-2-3p mature miRNA |
Sequence | 62 - AGAAUUGUGGCUGGACAUCUGU - 83 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|