miRBase entry: hsa-mir-219a-2

Stem-loop hsa-mir-219a-2


Accession
MI0000740
Symbol
HGNC: MIR219A2
Description
Homo sapiens hsa-mir-219a-2 precursor miRNA mir-219
Gene
family?
RF00251; mir-219

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR219A2 is a microRNA implicated in the differentiation of oligodendrocytes and the process of remyelination, and it has been observed to be downregulated in Alzheimer's disease (AD) patients' brains [PMC9822908]. In the context of AD, a study has shown that oligodendrocytes express fewer transcripts of genes like MIR219A2, which is essential for the maturation of myelin-forming cells [PMC6980793]. This downregulation was identified as a characteristic feature distinguishing clusters Oligo1 and Oligo2 in gene expression profiles [PMC6980793]. Furthermore, MIR219A2's reduced expression correlates with a decrease in genes that are crucial for myelination processes, such as those involved in axonal guidance and actin cytoskeleton rearrangement [PMC6980793]. The study's heatmap analysis specifically highlighted MIR219A2 among genes with significantly reduced expression that are typically involved in promoting myelination by aiding the differentiation from precursor cells to mature myelin-forming cells [PMC6980793]. In addition to AD, MIR219A2 upregulation has been noted relative to other subtypes in amyotrophic lateral sclerosis with transactive response DNA-binding protein 43 kDa pathology (ALS-TD), suggesting its role in transcriptional and translational dysregulation within this disease context as well [PMC9822908].

Literature search
70 open access papers mention hsa-mir-219a-2
(247 sentences)

Sequence

149557 reads, 3045 reads per million, 57 experiments
acucaggggcuucgccacUGAUUGUCCAAACGCAAUUCUuguacgagucugcggccaaccgAGAAUUGUGGCUGGACAUCUGUggcugagcuccggg
.(((.(((((((.(((((.(((.(((((..(((((((((((...(.(((...))))...)))))))))))..)))))))).))))).))))))))))

Structure
a   a       c     U   U     AA           uac a   u 
 cuc ggggcuu gccac GAU GUCCA  CGCAAUUCUug   g guc  
 ||| ||||||| ||||| ||| |||||  |||||||||||   | ||| g
 ggg ccucgag cggUG CUA CAGGU  GUGUUAAGAgc   c cgg  
-   -       u     U   -     CG           caa -   c 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later verified in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MIR:MI0000296) and mir-219-2 on chromosome 9 (MIR:MI0000740) [2].

Genome context
chr9: 128392618-128392714 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-219a-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-219a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-219a-5p

Accession MIMAT0000276
Description Homo sapiens hsa-miR-219a-5p mature miRNA
Sequence 19 - UGAUUGUCCAAACGCAAUUCU - 39
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-219a-2-3p

Accession MIMAT0004675
Description Homo sapiens hsa-miR-219a-2-3p mature miRNA
Sequence 62 - AGAAUUGUGGCUGGACAUCUGU - 83
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73