WARNING: This summary was generated by AI. MIR200A is a microRNA involved in the regulation of epithelial gene expression, and its methylation status has been studied in the context of A549 cells, a type of lung carcinoma cell line [PMC7948487]. Specifically, research has indicated that the regulatory regions of MIR200A undergo changes in H3K36 methylation, which is a marker associated with active transcription and can influence gene expression [PMC7948487]. In pathological conditions such as diabetes, MIR200A expression has been observed to decrease both in mesangial cells exposed to high glucose and in kidney tissues from diabetic mouse models [PMC5590408]. This downregulation of MIR200A is noteworthy as it occurs alongside the upregulation of miR-377 and downregulation of miR-141, suggesting a coordinated alteration in microRNA expression that could contribute to diabetic complications [PMC5590408].
c - c g - ----------- A cggg c ccu ugagCAUC UUACCGGACAGU GCUGG u |||| | ||| |||||||| |||||||||||| ||||| u gccc g gga acuUGUAG AAUGGUCUGUCA cgacc u c a u a C CAAUcucaguu c
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001620 |
| Description | Homo sapiens hsa-miR-200a-5p mature miRNA |
| Sequence | 16 - CAUCUUACCGGACAGUGCUGGA - 37 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000682 |
| Description | Homo sapiens hsa-miR-200a-3p mature miRNA |
| Sequence | 54 - UAACACUGUCUGGUAACGAUGU - 75 |
| Evidence |
experimental
cloned [3-5] |
| Database links |
|
| Predicted targets |
|
|