Stem-loop hsa-mir-29c

Accession

MI0000735

Symbol

HGNC: MIR29C

Description

Homo sapiens hsa-mir-29c precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR29C is a microRNA implicated in various cellular processes, including cell growth and the regulation of gene expression. Suppression of MIR29C in goose fatty liver is associated with increased tolerance to severe steatosis, suggesting a role in promoting cell growth during the overfeeding period [PMC6219092]. The expression of MIR29C is upregulated when lncRNA HOXA-AS3 is knocked down, indicating a regulatory relationship between these non-coding RNAs [PMC8489150]. Furthermore, MIR29C, along with miR29a, is transcriptionally repressed by the oncogene MYC, which consequently leads to increased expression of the monocarboxylate transporter 1 (MCT1) on tumor cells [PMC5406861]. Additionally, MIR29C is involved in the regulation of VEGFA mRNA levels and has been identified as part of a miRNA panel that can be used to calculate the probability of hepatocellular carcinoma (HCC) using a specific formula [PMC5770416; PMC9537616].. This panel includes other microRNAs and provides insight into how multiple miRNAs can cooperatively regulate gene expression and contribute to disease processes.

Literature search

512 open access papers mention hsa-mir-29c
(2674 sentences)

Sequence

388191 reads, 2141 reads per million, 135 experiments

aucucuuacacaggcUGACCGAUUUCUCCUGGUGUUCagagucuguuuuugucUAGCACCAUUUGAAAUCGGUUAugauguaggggga
..((((((((((...(((((((((((...(((((((.(((...........))))))))))...))))))))))))).))))))))..

Structure

au        -  ggc           UCC       C   gucu 
  cucuuaca ca   UGACCGAUUUC   UGGUGUU aga    g
  |||||||| ||   |||||||||||   ||||||| |||    u
  ggggaugu gu   AUUGGCUAAAG   ACCACGA Ucu    u
ag        a  ---           UUU       -   guuu 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr1: 207801852-207801939 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-29c

Disease association

hsa-mir-29c is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-29c-5p

• Accession: MIMAT0004673
• Description: Homo sapiens hsa-miR-29c-5p mature miRNA
• Sequence: 16 - UGACCGAUUUCUCCUGGUGUUC - 37
• Evidence: experimental ; cloned [3]

Mature hsa-miR-29c-3p

• Accession: MIMAT0000681
• Description: Homo sapiens hsa-miR-29c-3p mature miRNA
• Sequence: 54 - UAGCACCAUUUGAAAUCGGUUA - 75
• Evidence: experimental ; cloned [2-4]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739