miRBase entry: hsa-mir-128-2

Stem-loop hsa-mir-128-2


Accession
MI0000727
Symbol
HGNC: MIR128-2
Description
Homo sapiens hsa-mir-128-2 precursor miRNA mir-128
Gene
family?
RF00649; mir-128

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR128-2 is a microRNA gene implicated in various cellular processes, including apoptosis and drug resistance in cancer [PMC3566410]. It is co-expressed with its host gene ARPP21, and mutant TP53 has been shown to upregulate both MIR128-2 and ARPP21, suggesting a regulatory interaction [PMC4302087]. A specific A13G mutation in MIR128-2 disrupts the processing of its primary transcript, leading to reduced apoptosis and increased resistance to dexamethasone in t(4;11) ALL cells [PMC9406077]. Additionally, the R175H mutant TP53 variant upregulates MIR128-2 expression, which then targets E2F5 to enhance p21 expression, inhibiting apoptosis and conferring resistance to several chemotherapeutic agents [PMC7749743]. MIR128-2 has been identified as an oncogenic microRNA with prognostic value for gastrointestinal integrity (GI) and is part of a three-miRNA signature (miGISig) predictive of GI-related clinical outcomes [PMC7802300]. It shares the mature miR-128 sequence with MIR128-1 but has distinct regulatory roles across different cancer types [PMC7802300]. The expression of MIR128-2 relative to its host gene ARPP21 remains an area for further investigation due to the presence of a Pol III promoter in its 5′ flanking region [PMC5346679].

Literature search
174 open access papers mention hsa-mir-128-2
(979 sentences)

Sequence

175902 reads, 732 reads per million, 134 experiments
ugugcagugggaagGGGGGCCGAUACACUGUACGAGAgugaguagcaggucUCACAGUGAACCGGUCUCUUUcccuacuguguc
...((((((((.((((((((((...((((((..((((.(........).))))))))))...)))))))))).))))))))...

Structure
ugu        a          AUA      AC    g gag 
   gcaguggg agGGGGGCCG   CACUGU  GAGA u   u
   |||||||| ||||||||||   ||||||  |||| |    
   ugucaucc UUUCUCUGGC   GUGACA  CUcu g   a
cug        c          CAA      --    g acg 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
chr3: 35744476-35744559 [+]

Disease association
hsa-mir-128-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-128-3p

Accession MIMAT0000424
Description Homo sapiens hsa-miR-128-3p mature miRNA
Sequence 52 - UCACAGUGAACCGGUCUCUUU - 72
Evidence experimental
cloned [3], Illumina [4]
Database links
Predicted targets

Mature hsa-miR-128-2-5p

Accession MIMAT0031095
Description Homo sapiens hsa-miR-128-2-5p mature miRNA
Sequence 15 - GGGGGCCGAUACACUGUACGAGA - 37
Evidence experimental
Illumina [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45