MIR193A, a microRNA, has been observed to be overexpressed in podocytes in primary FSGS biopsies, while genetic FSGS and minimal change disease show low MIR193A levels, similar to normal kidneys [PMC9953542]. Contrary to the suggestion of overexpression's regulatory interaction with VDR/RXR expression, the context actually suggests a causal relationship between VDR/RXR expression and downregulation of MIR193A [PMC7226544]. In vitro studies have demonstrated that MIR193A can inhibit micro-vessel formation, indicating its role in cellular processes [PMC9562882]. The expression levels of MIR193A by precursor progenitor cells are crucial for determining their differentiation into either parietal epithelial cells (PECs) or podocytes through the modulation of WT1 [PMC9953542]. The activity of MIR193A is influenced by its 3’ UTR position relative to the stop codon and the location of its seed region [PMC7226544]. In hepatocellular carcinoma (HCC), down-modulation of MIR193A has been associated with disease diagnosis and prognosis, and unlike miR-23b, it is not regulated by DNA methylation [PMC5351682]. Transcription factors such as YY1, WT1, and Sox2 have potential regulatory roles on MIR193A expression through binding to its promoter region [PMC7226544]. Advanced mouse colon cancer cells have been found to secrete exosomes containing MVP along with tumor-suppressive MIR193A [PMC7916137], and MIR193A is suggested to bind to the APOL1 3’ UTR region mRNA, affecting cytoskeletal organization in podocytes [PMC8391400; PMC7226544]..
cgaggau a U C G A gggu ggg gcugagggcUGGG CUUUG GGGC AG UGA g ||| ||||||||||||| ||||| |||| || ||| ccc cggcucuUGACCC GAAAC UCCG UC Acu u ------g c U A G A aggc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004614 |
Description | Homo sapiens hsa-miR-193a-5p mature miRNA |
Sequence | 21 - UGGGUCUUUGCGGGCGAGAUGA - 42 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000459 |
Description | Homo sapiens hsa-miR-193a-3p mature miRNA |
Sequence | 55 - AACUGGCCUACAAAGUCCCAGU - 76 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|