Stem-loop hsa-mir-190a

Accession

MI0000486

Symbol

HGNC: MIR190A

Description

Homo sapiens hsa-mir-190a precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR190A, a microRNA, has been implicated in various biological pathways and diseases, including its significant role in the microbiota-gut-brain (MGB) axis [PMC8615526]. While it is listed among miRNAs that could be responsible for early onset of fibrosis in double-infected transplanted livers, its specific role in the downregulation of miRNAs associated with extracellular matrix remodeling has not been detailed [PMC8869900]. MIR190A has been shown to facilitate bladder cancer (BC) invasion and autophagy by stabilizing ATG7 mRNA through binding to its 3′UTR [PMC8514698], [PMC7226452]. This regulatory effect is further supported by evidence from ectopic expression studies and the use of MIR190A specific antisense in BC cells [PMC6468970]. The overexpression of MIR190A promotes BC invasion and autophagy, while its inhibition leads to increased PHLPP1 protein expression and reduced ATG7 protein expression [PMC6468970]. The upregulation of MIR190A has also been observed in human invasive BCs and is associated with increased ATG7 mRNA stabilization, further linking it to BC invasion both in vitro and in vivo [PMC6468970].

Literature search

43 open access papers mention hsa-mir-190a
(214 sentences)

Sequence

8022 reads, 127 reads per million, 94 experiments

ugcaggccucugugUGAUAUGUUUGAUAUAUUAGGUuguuauuuaauccaaCUAUAUAUCAAACAUAUUCCUacagugucuugcc
.(((((.(.(((((.((((((((((((((((..(((((..........)))))))))))))))))))))..))))).).))))).

Structure

u     c u     -U                UA     uuau 
 gcagg c cugug  GAUAUGUUUGAUAUAU  GGUug    u
 ||||| | |||||  ||||||||||||||||  |||||     
 cguuc g gacaU  UUAUACAAACUAUAUA  UCaac    u
c     u u     CC                --     cuaa 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

chr15: 62823957-62824041 [+]

Disease association

hsa-mir-190a is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-190a-5p

• Accession: MIMAT0000458
• Description: Homo sapiens hsa-miR-190a-5p mature miRNA
• Sequence: 15 - UGAUAUGUUUGAUAUAUUAGGU - 36
• Evidence: experimental ; cloned [2], Illumina [3]

Mature hsa-miR-190a-3p

• Accession: MIMAT0026482
• Description: Homo sapiens hsa-miR-190a-3p mature miRNA
• Sequence: 52 - CUAUAUAUCAAACAUAUUCCU - 72
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45