miRBase entry: hsa-mir-9-2

Stem-loop hsa-mir-9-2


Accession
MI0000467
Symbol
HGNC: MIR9-2
Description
Homo sapiens hsa-mir-9-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR9-2 is a gene belonging to the mir-9 family, which plays a significant role in neurogenesis and is located on chromosome 5 [PMC6723948]. It is situated downstream of the LINC00461 gene, and the expression of mir-9 is notably affected by LINC00461, suggesting a regulatory relationship between these two genes [PMC6723948]. The methylation status of MIR9-2 in tumor tissues and their normal margins has been studied to understand its potential correlation with clinopathological features [PMC5019297]. Additionally, MIR9-2 has been linked to attention-deficit/hyperactivity disorder (ADHD) through its association with the rs4916723 polymorphism [PMC6723948]. The major transcript produced by MIR9-2, along with MIR9-1 and MIR9-3 genes, is miR-9-5p [PMC6162741]. Furthermore, regulatory motifs significant for the control of MIR9-2 have been identified in its genomic region [PMC5366901]. In terms of gene regulation, it has been shown that Tbr2 and Tbr1 directly repress the expression of miR-9*, which is encoded by MIR9-2 [PMC6113890].

Literature search
539 open access papers mention hsa-mir-9-2
(3355 sentences)

Sequence

663466 reads, 1291 reads per million, 111 experiments
ggaagcgaguuguuaUCUUUGGUUAUCUAGCUGUAUGAguguauuggucuucAUAAAGCUAGAUAACCGAAAGUaaaaacuccuuca
.((((.(((((.((((.(((((((((((((((.((((((.(.......))))))).))))))))))))))).)))).))))))))).

Structure
g    c     g    C               G      u ua 
 gaag gaguu uuaU UUUGGUUAUCUAGCU UAUGAg g  u
 |||| ||||| |||| ||||||||||||||| |||||| |  u
 cuuc cucaa aaUG AAGCCAAUAGAUCGA AUAcuu c  g
a    -     a    A               A      - ug 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 88666853-88666939 [-]

Disease association
hsa-mir-9-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-9-5p

Accession MIMAT0000441
Description Homo sapiens hsa-miR-9-5p mature miRNA
Sequence 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-9-3p

Accession MIMAT0000442
Description Homo sapiens hsa-miR-9-3p mature miRNA
Sequence 53 - AUAAAGCUAGAUAACCGAAAGU - 74
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739