MIR191 is a microRNA (miRNA) that has been identified as notably expressed across various tumor types and is considered a key miRNA ortholog among those that are mutually abundant in these tumors [PMC9210832]. In the context of malignant hyperthermia (MHT), the concentration of MIR191 in patients may serve as a valuable biomarker, potentially aiding in the decision-making process regarding the necessity for an initial cranial computed tomography (CCT) scan [PMC7430915]. Research has also been conducted on modified peptide nucleic acids (MEPNAs) for MIR191, with four different MEPNAs being synthesized, each with varying gap sizes of unmodified nucleotide units, to explore their potential applications [PMC4005664].
c u c CA C AA --u cu ggc gga agcggg ACGGAAUCC AA GCAGCUG ugu c ||| ||| |||||| ||||||||| || ||||||| ||| c ccg ccu ucguCC UGCUUUAGG UU CGUCGac acg a u u c CC - CG cuu ag
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000440 |
| Description | Homo sapiens hsa-miR-191-5p mature miRNA |
| Sequence | 16 - CAACGGAAUCCCAAAAGCAGCUG - 38 |
| Evidence |
experimental
cloned [2-5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0001618 |
| Description | Homo sapiens hsa-miR-191-3p mature miRNA |
| Sequence | 58 - GCUGCGCUUGGAUUUCGUCCCC - 79 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
|