Stem-loop hsa-mir-191

Accession

MI0000465

Symbol

HGNC: MIR191

Description

Homo sapiens hsa-mir-191 precursor miRNA mir-191

Gene
family

RF00764; mir-191

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR191 is a microRNA (miRNA) that has been identified as notably expressed across various tumor types and is considered a key miRNA ortholog among those that are mutually abundant in these tumors [PMC9210832]. In the context of malignant hyperthermia (MHT), the concentration of MIR191 in patients may serve as a valuable biomarker, potentially aiding in the decision-making process regarding the necessity for an initial cranial computed tomography (CCT) scan [PMC7430915]. Research has also been conducted on modified peptide nucleic acids (MEPNAs) for MIR191, with four different MEPNAs being synthesized, each with varying gap sizes of unmodified nucleotide units, to explore their potential applications [PMC4005664].

Literature search

166 open access papers mention hsa-mir-191
(853 sentences)

Sequence

1515639 reads, 8115 reads per million, 146 experiments

cggcuggacagcgggCAACGGAAUCCCAAAAGCAGCUGuugucuccagagcauuccaGCUGCGCUUGGAUUUCGUCCCCugcucuccugccu
.(((.(((.((((((..(((((((((.((..(((((((.(((.......)))...)))))))..)))))))))))..)))))).))).))).

Structure

c   u   c      CA         C  AA       --u   cu 
 ggc gga agcggg  ACGGAAUCC AA  GCAGCUG   ugu  c
 ||| ||| ||||||  ||||||||| ||  |||||||   |||  c
 ccg ccu ucguCC  UGCUUUAGG UU  CGUCGac   acg  a
u   u   c      CC         -  CG       cuu   ag 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chr3: 49020618-49020709 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-191

Disease association

hsa-mir-191 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-191-5p

• Accession: MIMAT0000440
• Description: Homo sapiens hsa-miR-191-5p mature miRNA
• Sequence: 16 - CAACGGAAUCCCAAAAGCAGCUG - 38
• Evidence: experimental ; cloned [2-5]

Mature hsa-miR-191-3p

• Accession: MIMAT0001618
• Description: Homo sapiens hsa-miR-191-3p mature miRNA
• Sequence: 58 - GCUGCGCUUGGAUUUCGUCCCC - 79
• Evidence: experimental ; cloned [2-4]

References

1. PubMed ID: 15325244
   Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
   "Kasashima K, Nakamura Y, Kozu T"
   "Biochem Biophys Res Commun (2004) 322:403-410


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


4. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179


5. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706