miRBase entry: hsa-mir-145

Stem-loop hsa-mir-145


Accession
MI0000461
Symbol
HGNC: MIR145
Description
Homo sapiens hsa-mir-145 precursor miRNA mir-145
Gene
family?
RF00675; mir-145

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR145, a microRNA transcribed alongside miR143 from a single precursor molecule, plays a role in regulating stem cell pluripotency [PMC7956570]. It has been observed that in diabetic nephropathy (DN) patients, MIR145 levels are significantly elevated in urinary extracellular vesicles (uEVs) and increase further with the onset of proteinuria [PMC9603196]. In mouse models, the loss of the transcription factor Sox2 has been linked to an increase in MIR145 levels, which subsequently leads to a decrease in Sox9 protein levels [PMC3865748]. In the context of cancer, MIR145 has been implicated in epigenetic alterations such as promoter hypermethylation in pituitary tumors [PMC7281098], and it has been included as part of a logistic regression model that effectively distinguishes non-small cell lung cancer (NSCLC) patients from controls with high sensitivity and specificity [PMC6463117]. Additionally, MIR145 upregulation has been documented in the blood of idiopathic pulmonary arterial hypertension (IPAH) patients, suggesting its significant role in disease pathophysiology [PMC4357130]. Furthermore, miRNA-145's host gene is identified as ENSG00000269936 and is considered a potential biomarker for breast cancer diagnosis [PMC6786248], while its therapeutic potential is highlighted by its inclusion alongside other tumor suppressor miRs to inhibit colon cancer tumorigenesis upon oral administration in mice models [PMC7147085].

Literature search
668 open access papers mention hsa-mir-145
(4250 sentences)

Sequence

1428616 reads, 13141 reads per million, 150 experiments
caccuuguccucacgGUCCAGUUUUCCCAGGAAUCCCUuagaugcuaagauggGGAUUCCUGGAAAUACUGUUCUugaggucaugguu
.(((.((.(((((.((..((((.((.((((((((((((.............)))))))))))).)).))))..))))))).)).))).

Structure
c   u  u     c  UC    U  C            uagau 
 acc ug ccuca gG  CAGU UU CCAGGAAUCCCU     g
 ||| || ||||| ||  |||| || ||||||||||||     c
 ugg ac ggagu UC  GUCA AA GGUCCUUAGGgg     u
u   u  u     -  UU    U  A            uagaa 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-145 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr5: 149430646-149430733 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-145
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-145 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-145 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-145 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-145-5p

Accession MIMAT0000437
Description Homo sapiens hsa-miR-145-5p mature miRNA
Sequence 16 - GUCCAGUUUUCCCAGGAAUCCCU - 38
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-145-3p

Accession MIMAT0004601
Description Homo sapiens hsa-miR-145-3p mature miRNA
Sequence 54 - GGAUUCCUGGAAAUACUGUUCU - 75
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739