MIR145, a microRNA transcribed alongside miR143 from a single precursor molecule, plays a role in regulating stem cell pluripotency [PMC7956570]. It has been observed that in diabetic nephropathy (DN) patients, MIR145 levels are significantly elevated in urinary extracellular vesicles (uEVs) and increase further with the onset of proteinuria [PMC9603196]. In mouse models, the loss of the transcription factor Sox2 has been linked to an increase in MIR145 levels, which subsequently leads to a decrease in Sox9 protein levels [PMC3865748]. In the context of cancer, MIR145 has been implicated in epigenetic alterations such as promoter hypermethylation in pituitary tumors [PMC7281098], and it has been included as part of a logistic regression model that effectively distinguishes non-small cell lung cancer (NSCLC) patients from controls with high sensitivity and specificity [PMC6463117]. Additionally, MIR145 upregulation has been documented in the blood of idiopathic pulmonary arterial hypertension (IPAH) patients, suggesting its significant role in disease pathophysiology [PMC4357130]. Furthermore, miRNA-145's host gene is identified as ENSG00000269936 and is considered a potential biomarker for breast cancer diagnosis [PMC6786248], while its therapeutic potential is highlighted by its inclusion alongside other tumor suppressor miRs to inhibit colon cancer tumorigenesis upon oral administration in mice models [PMC7147085].
c u u c UC U C uagau acc ug ccuca gG CAGU UU CCAGGAAUCCCU g ||| || ||||| || |||| || |||||||||||| c ugg ac ggagu UC GUCA AA GGUCCUUAGGgg u u u u - UU U A uagaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000437 |
Description | Homo sapiens hsa-miR-145-5p mature miRNA |
Sequence | 16 - GUCCAGUUUUCCCAGGAAUCCCU - 38 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004601 |
Description | Homo sapiens hsa-miR-145-3p mature miRNA |
Sequence | 54 - GGAUUCCUGGAAAUACUGUUCU - 75 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|