miRBase entry: hsa-mir-144

Stem-loop hsa-mir-144


Accession
MI0000460
Symbol
HGNC: MIR144
Description
Homo sapiens hsa-mir-144 precursor miRNA mir-144
Gene
family?
RF00682; mir-144

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR144 is a microRNA that plays a regulatory role in various cellular processes, influencing adipocyte differentiation and energy metabolism by inducing brown/beige-like characteristics in differentiated adipocytes through the downregulation of the MAP3K8/ERK1/2/PPARγ axes [PMC9779381]. It has been found that overexpression of MIR144 significantly increases the expression of human GRβ without affecting GRα, suggesting a selective effect on glucocorticoid receptor subtypes [PMC5053652]. Additionally, MIR144 has been implicated in disrupting the binding of miR153, miR27a, and miR142-5p to the human Nrf2 3′ UTR, thereby identifying Nrf2 as a direct target and potentially influencing oxidative stress responses [PMC3517581]. The microRNA also reduces mRNA levels of c-Met and ADAM10, which are key molecules in cell growth and neurodevelopment [PMC7352235]. The expression of MIR144 is regulated by components of the AP1 complex, linking it to transcription factors associated with cell proliferation and apoptosis [PMC7123062]. Moreover, increased levels of MIR144 have been reported in colorectal cancer tissues, suggesting a role in cancer biology [PMC4599290].

Literature search
164 open access papers mention hsa-mir-144
(963 sentences)

Sequence

120704 reads, 1971 reads per million, 101 experiments
uggggcccuggcugGGAUAUCAUCAUAUACUGUAAGuuugcgaugagacacUACAGUAUAGAUGAUGUACUaguccgggcaccccc
.(((((((.((((((.((((((((.(((((((((.((((......))))..))))))))))))))))).)))))).)))).)))..

Structure
-u   -    u      G        A         -A    gc 
  ggg gccc ggcugG AUAUCAUC UAUACUGUA  Guuu  g
  ||| |||| |||||| |||||||| |||||||||  ||||   
  ccc cggg cugaUC UGUAGUAG AUAUGACAU  caga  a
cc   a    c      A        -         ca    gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr17: 28861533-28861618 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from hsa-mir-144
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-144 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-144 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-144 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-144-5p

Accession MIMAT0004600
Description Homo sapiens hsa-miR-144-5p mature miRNA
Sequence 15 - GGAUAUCAUCAUAUACUGUAAG - 36
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-144-3p

Accession MIMAT0000436
Description Homo sapiens hsa-miR-144-3p mature miRNA
Sequence 52 - UACAGUAUAGAUGAUGUACU - 71
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739