MIR143 is a microRNA that has been studied in the context of obesity and ovarian function [PMC9687157]. In a study, it was found that the levels of MIR143 were negatively correlated with the mRNA levels of inflammatory cytokines IL1β, IL6, and TNFα in the ovaries of obese individuals [PMC9687157]. This suggests that MIR143 may play a role in regulating inflammation in obese individuals. Additionally, over-expression of MIR143 led to decreased expression of predicted target proteins HK2 and ADRB1, as well as a reduced Bcl-2/Bax ratio [PMC5735881]. This indicates that MIR143 may also be involved in regulating cellular metabolism and apoptosis. These findings highlight the potential importance of MIR143 in obesity-related ovarian dysfunction and provide insights into its molecular mechanisms [PMC9687157] [PMC5735881]. Further research is needed to fully understand the role of MIR143 in these processes and its potential as a therapeutic target for obesity-related disorders [PMC9687157] [PMC5735881].
- c ccug c ag G G U - ag gc gcag gc ucuc c ccugaG UGCAGUGCU CAUCUC GG Uc u || |||| || |||| | |||||| ||||||||| |||||| || || cg cguc ug agag g ggaCUC AUGUCACGA GUAGAG cu ag u a u uuga a aa G A U g gg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004599 |
Description | Homo sapiens hsa-miR-143-5p mature miRNA |
Sequence | 27 - GGUGCAGUGCUGCAUCUCUGGU - 48 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0000435 |
Description | Homo sapiens hsa-miR-143-3p mature miRNA |
Sequence | 61 - UGAGAUGAAGCACUGUAGCUC - 81 |
Evidence |
experimental
cloned [2-3], Illumina [4] |
Database links | |
Predicted targets |
|