WARNING: This summary was generated by AI. MIR135A1 is a microRNA gene located on human chromosome 3p21.2, which, along with MIR135A2 on chromosome 12q23.1, encodes for the miR-135a family members in mice [PMC3861205][PMC10101835[PMC10101835]. These microRNAs, including MIR135A1, are situated in genomic regions with frequent copy number losses (CNLs) in tumor suppressor genes (TSGs), indicating their potential role in cancer [PMC5001246]. MIR135A1 is also part of a regulatory network involving the WAC gene and other microRNAs [PMC3948699]. Despite their importance, no significant differences were observed in the methylation status of the promoter regions of MIR135A1 and MIR135A2 between two analyzed clusters of samples [PMC9885701]. Additionally, copy number variations (CNVs) for these genes did not show significant differences between these clusters either [PMC9885701]. The promoter sequences for these genes were analyzed to understand transcriptional regulation differences that might explain variations in miR-135a-5p expression between clusters [PMC9885701]. Frequent deletion of the MIR135A1 locus has been associated with poor prognosis in primary breast cancers, suggesting its importance as a potential prognostic marker or therapeutic target [PMC9486161].
agg u u UU uucua ccucgcugu c cUAUGGCUUU AUUCCUAUGUGA c ||||||||| | |||||||||| |||||||||||| u ggggcggca G GGUGCCGAGG UAGGGAUAUacu g aca c C -U cacuc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000428 |
| Description | Homo sapiens hsa-miR-135a-5p mature miRNA |
| Sequence | 17 - UAUGGCUUUUUAUUCCUAUGUGA - 39 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004595 |
| Description | Homo sapiens hsa-miR-135a-3p mature miRNA |
| Sequence | 56 - UAUAGGGAUUGGAGCCGUGGCG - 77 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|