miRBase entry: hsa-mir-135a-1

Stem-loop hsa-mir-135a-1


Accession
MI0000452
Symbol
HGNC: MIR135A1
Description
Homo sapiens hsa-mir-135a-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR135A1 is a microRNA gene located on human chromosome 3p21.2, which, along with MIR135A2 on chromosome 12q23.1, encodes for the miR-135a family members in mice [PMC3861205][PMC10101835[PMC10101835]. These microRNAs, including MIR135A1, are situated in genomic regions with frequent copy number losses (CNLs) in tumor suppressor genes (TSGs), indicating their potential role in cancer [PMC5001246]. MIR135A1 is also part of a regulatory network involving the WAC gene and other microRNAs [PMC3948699]. Despite their importance, no significant differences were observed in the methylation status of the promoter regions of MIR135A1 and MIR135A2 between two analyzed clusters of samples [PMC9885701]. Additionally, copy number variations (CNVs) for these genes did not show significant differences between these clusters either [PMC9885701]. The promoter sequences for these genes were analyzed to understand transcriptional regulation differences that might explain variations in miR-135a-5p expression between clusters [PMC9885701]. Frequent deletion of the MIR135A1 locus has been associated with poor prognosis in primary breast cancers, suggesting its importance as a potential prognostic marker or therapeutic target [PMC9486161].

Literature search
153 open access papers mention hsa-mir-135a-1
(512 sentences)

Sequence

7503 reads, 23 reads per million, 117 experiments
aggccucgcuguucucUAUGGCUUUUUAUUCCUAUGUGAuucuacugcucacucaUAUAGGGAUUGGAGCCGUGGCGcacggcggggaca
...(((((((((.(.((((((((((..((((((((((((.............)))))))))))).)))))))))).).)))))))))...

Structure
agg         u u          UU            uucua 
   ccucgcugu c cUAUGGCUUU  AUUCCUAUGUGA     c
   ||||||||| | ||||||||||  ||||||||||||     u
   ggggcggca G GGUGCCGAGG  UAGGGAUAUacu     g
aca         c C          -U            cacuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
chr3: 52294219-52294308 [-]

Disease association
hsa-mir-135a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-135a-5p

Accession MIMAT0000428
Description Homo sapiens hsa-miR-135a-5p mature miRNA
Sequence 17 - UAUGGCUUUUUAUUCCUAUGUGA - 39
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-135a-3p

Accession MIMAT0004595
Description Homo sapiens hsa-miR-135a-3p mature miRNA
Sequence 56 - UAUAGGGAUUGGAGCCGUGGCG - 77
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739