MIR133A2 is a gene encoding the miR-133a2 microRNA, located on chromosome 20 at 20q13.33, and is one of the two genes responsible for the production of mature miR-133a in humans [PMC3323546]. This gene was found to have a copy number gain in approximately 7% of patients, indicating its potential involvement in disease [PMC4967895]. A specific variant, 79T > C MIR133A2, located outside the seed region of the mature miRNA, was identified and shown to affect miRNA duplex processing by altering the relative abundance of miR-133a-3p and miR-133a-5p strands [PMC3599331]. This variant leads to an increased relative abundance of miR-133a-5p without affecting target gene expression for miR-133a-3p [PMC3599331]. The presence of this MIR133A2 variant could potentially modify gene expression profiles in cardiac tissue and has been associated with a patient exhibiting atrial fibrillation [PMC3599331]. Additionally, this variant is positioned adjacent to the Drosha cleavage site in the stem-loop structure at the 3′ end of miR-133a, which could have implications for its processing and function [PMC3599331].
g a -- uuu g AA U A g cug gg gcca aaugc gcua AGCUGGU AA GG ACCAAAUc a u || |||| ||||| |||| ||||||| || || |||||||| | cc cggu uuacg cgau UCGACCA UU CC UGGUUUag u c g g ag ugu G AC C C g aac
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000427 |
| Description | Homo sapiens hsa-miR-133a-3p mature miRNA |
| Sequence | 59 - UUUGGUCCCCUUCAACCAGCUG - 80 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026478 |
| Description | Homo sapiens hsa-miR-133a-5p mature miRNA |
| Sequence | 22 - AGCUGGUAAAAUGGAACCAAAU - 43 |
| Evidence |
experimental
Illumina [3] |
| Database links |
|
| Predicted targets |
|
|