miRBase entry: hsa-mir-133a-1

Stem-loop hsa-mir-133a-1


Accession
MI0000450
Symbol
HGNC: MIR133A1
Description
Homo sapiens hsa-mir-133a-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR133A1 is a gene encoding the miR-133a1 microRNA, located on chromosome 18q11.2, and is one of the two genes responsible for the production of mature miR-133a in humans [PMC6522747]. This microRNA is predominantly expressed in muscle tissues and is implicated in muscle differentiation and myogenesis [PMC5137429]. It has been identified as a downregulated gene in glioma samples when compared to normal samples, suggesting its potential role as an oncosuppressor RNA gene (OSRG) [PMC8634738]. During cardiomyogenesis from pluripotent stem cells, MIR133A1 expression increases by day 10, indicating its importance in cardiac lineage differentiation [PMC6828809]. Furthermore, MIR133A1 has been shown to promote pre-cardiac mesoderm development while inhibiting endodermal and neuroectodermal lineages [PMC6828809]. In the context of prostate tumors, MIR133A1 downregulation due to overexpression of transcription factor ESF1 leads to upregulation of EGFR, which is associated with cell proliferation and metastasis [PMC8840188]. Genetic screening studies have included MIR133A1 to investigate its role in familial atrial fibrillation (AF), highlighting its significance in cardiac-related conditions [PMC3599331].

Literature search
384 open access papers mention hsa-mir-133a-1
(1856 sentences)

Sequence

29524 reads, 680 reads per million, 119 experiments
acaaugcuuugcuagAGCUGGUAAAAUGGAACCAAAUcgccucuucaauggaUUUGGUCCCCUUCAACCAGCUGuagcuaugcauuga
.((((((...((((.(((((((..((.((.((((((((............)))))))).)).))..))))))).))))...)))))).

Structure
a      uuu    g       AA  U  A        gccuc 
 caaugc   gcua AGCUGGU  AA GG ACCAAAUc     u
 ||||||   |||| |||||||  || || ||||||||      
 guuacg   cgau UCGACCA  UU CC UGGUUUag     u
a      uau    G       AC  C  C        guaac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr18: 21825698-21825785 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-133a-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-133a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-133a-3p

Accession MIMAT0000427
Description Homo sapiens hsa-miR-133a-3p mature miRNA
Sequence 53 - UUUGGUCCCCUUCAACCAGCUG - 74
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-133a-5p

Accession MIMAT0026478
Description Homo sapiens hsa-miR-133a-5p mature miRNA
Sequence 16 - AGCUGGUAAAAUGGAACCAAAU - 37
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45