Stem-loop hsa-mir-133a-1

Accession

MI0000450

Symbol

HGNC: MIR133A1

Description

Homo sapiens hsa-mir-133a-1 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR133A1 is a gene encoding the miR-133a1 microRNA, located on chromosome 18q11.2, and is one of the two genes responsible for the production of mature miR-133a in humans [PMC6522747]. This microRNA is predominantly expressed in muscle tissues and is implicated in muscle differentiation and myogenesis [PMC5137429]. It has been identified as a downregulated gene in glioma samples when compared to normal samples, suggesting its potential role as an oncosuppressor RNA gene (OSRG) [PMC8634738]. During cardiomyogenesis from pluripotent stem cells, MIR133A1 expression increases by day 10, indicating its importance in cardiac lineage differentiation [PMC6828809]. Furthermore, MIR133A1 has been shown to promote pre-cardiac mesoderm development while inhibiting endodermal and neuroectodermal lineages [PMC6828809]. In the context of prostate tumors, MIR133A1 downregulation due to overexpression of transcription factor ESF1 leads to upregulation of EGFR, which is associated with cell proliferation and metastasis [PMC8840188]. Genetic screening studies have included MIR133A1 to investigate its role in familial atrial fibrillation (AF), highlighting its significance in cardiac-related conditions [PMC3599331].

Literature search

384 open access papers mention hsa-mir-133a-1
(1856 sentences)

Sequence

29524 reads, 247 reads per million, 119 experiments

acaaugcuuugcuagAGCUGGUAAAAUGGAACCAAAUcgccucuucaauggaUUUGGUCCCCUUCAACCAGCUGuagcuaugcauuga
.((((((...((((.(((((((..((.((.((((((((............)))))))).)).))..))))))).))))...)))))).

Structure

a      uuu    g       AA  U  A        gccuc 
 caaugc   gcua AGCUGGU  AA GG ACCAAAUc     u
 ||||||   |||| |||||||  || || ||||||||      
 guuacg   cgau UCGACCA  UU CC UGGUUUag     u
a      uau    G       AC  C  C        guaac 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

chr18: 21825698-21825785 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-133a-1

Disease association

hsa-mir-133a-1 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-133a-3p

• Accession: MIMAT0000427
• Description: Homo sapiens hsa-miR-133a-3p mature miRNA
• Sequence: 53 - UUUGGUCCCCUUCAACCAGCUG - 74
• Evidence: experimental ; cloned [2], Illumina [3]

Mature hsa-miR-133a-5p

• Accession: MIMAT0026478
• Description: Homo sapiens hsa-miR-133a-5p mature miRNA
• Sequence: 16 - AGCUGGUAAAAUGGAACCAAAU - 37
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45