MIR130A is a microRNA that has been identified as one of the miRNAs enriched in extracellular vesicles (EVs) from melanoma cells, which is associated with the metastatic process of this skin cancer [PMC9871288]. Studies have demonstrated that MIR130A plays a significant role in various biological processes, and its inhibition has been linked to positive outcomes in the context of cerebral ischemia [PMC6732937]. Specifically, targeting MIR130A has been shown to decrease blood-brain barrier (BBB) permeability and brain edema while improving neurological functions by influencing the expression of Homeobox1 [PMC6732937]. This suggests that MIR130A could be a potential therapeutic target not only for melanoma metastasis but also for conditions involving cerebral ischemia and BBB integrity [PMC9871288; PMC6732937]..
u - a C A ucu a gcugc uggccag GCUCUUUU ACAUUGUGCU CUg gc c ||||| ||||||| |||||||| |||||||||| ||| || ugaug gccgguU CGGGAAAA UGUAACGUGA gau ug c g u A U C cac u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004593 |
| Description | Homo sapiens hsa-miR-130a-5p mature miRNA |
| Sequence | 15 - GCUCUUUUCACAUUGUGCUACU - 36 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000425 |
| Description | Homo sapiens hsa-miR-130a-3p mature miRNA |
| Sequence | 55 - CAGUGCAAUGUUAAAAGGGCAU - 76 |
| Evidence |
experimental
cloned [2-4], Northern [2] |
| Database links |
|
| Predicted targets |
|
|