MIR128-1 is a gene that plays a crucial role in the regulation of protein interactions within cells, specifically by targeting the protein Bmi1, which in turn affects the protein cadherin encoded by CDH1 [PMC5320387]. This gene is noteworthy for producing identical mature miR-128-3p sequences as its counterpart, MIR128-2, while also encoding for miR-128-1-5p species that are slightly different from the miR-128-2-5p species encoded by MIR128-2 [PMC5481840].
u u uuC UAG CU u gagc guugga GGGGCCG CACUGU GAGAggu u |||| |||||| ||||||| |||||| ||||||| uucg cgacuu CUCUGGC GUGACA CUcuuua a c u UUU CAA -- c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000424 |
| Description | Homo sapiens hsa-miR-128-3p mature miRNA |
| Sequence | 50 - UCACAGUGAACCGGUCUCUUU - 70 |
| Evidence |
experimental
cloned [3], Illumina [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026477 |
| Description | Homo sapiens hsa-miR-128-1-5p mature miRNA |
| Sequence | 15 - CGGGGCCGUAGCACUGUCUGAGA - 37 |
| Evidence |
experimental
Illumina [4] |
| Database links |
|
| Predicted targets |
|
|