Stem-loop hsa-mir-23b

Accession

MI0000439

Symbol

HGNC: MIR23B

Description

Homo sapiens hsa-mir-23b precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Hsa-mir-23b is a microRNA that has been found to be present in the saliva of patients diagnosed with intraductal papillary mucinous neoplasm (IPMN) and could potentially be used in the management of IPMN [PMC4486170]. In a study, 16 miRNAs were found to be significantly up-regulated, including hsa-miR-32, hsa-miR-19a, hsa-miR-18b, hsa-miR-96, hsa-miR-183, hsa-miR-130b, hsa-miR-182, hsa-miR-18a, hsa-miR-375, hsa-miR-106a, hsa-miR-106b, hsa-mir-425, hsa-mir17a and 25 [PMC5788610]. Additionally 13 miRNAs were significantly down-regulated including has miRNA 100 and has miRNA 23a [PMC5788610]. HSA mir23b is also down-regulated in IPMN patients [PMC5788610]. These findings suggest that the dysregulation of these miRNAs may play a role in the development and progression of IPMN. Further research is needed to fully understand the functional significance of these dysregulated miRNAs and their potential as diagnostic or prognostic markers for IPMN. The study provides valuable insights into the potential use of saliva-based biomarkers for decision making in IPMN management. The identification of specific dysregulated miRNAs such as has mir23b could potentially lead to improved diagnostic and therapeutic strategies for patients with IPMN [PMC4486170] [PMC5788610].

Literature search

292 open access papers mention hsa-mir-23b
(1581 sentences)

Sequence

734253 reads, 4243 reads per million, 135 experiments

cucaggugcucuggcugcuUGGGUUCCUGGCAUGCUGAUUUgugacuuaagauuaaaAUCACAUUGCCAGGGAUUACCACgcaaccacgaccuuggc
.(((((.(.(((((.(((.(((((((((((((((.((((((..............)))))))).))))))))))..))).))).))).)))))))).

Structure

c     u c  -   c   u   --          -  C      gugacu 
 ucagg g uc ugg ugc UGG  GUUCCUGGCA UG UGAUUU      u
 ||||| | || ||| ||| |||  |||||||||| || ||||||       
 gguuc c ag acc acg ACC  UAGGGACCGU AC ACUAaa      a
c     - -  c   a   C   AU          U  -      auuaga 

Annotation confidence Not enough data

Genome context

chr9: 95085208-95085304 [+]

Clustered miRNAs

3 other miRNAs are < 10 kb from hsa-mir-23b

Disease association

hsa-mir-23b is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-23b is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-23b is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-23b-5p

• Accession: MIMAT0004587
• Description: Homo sapiens hsa-miR-23b-5p mature miRNA
• Sequence: 20 - UGGGUUCCUGGCAUGCUGAUUU - 41
• Evidence: experimental ; cloned [3]

Mature hsa-miR-23b-3p

• Accession: MIMAT0000418
• Description: Homo sapiens hsa-miR-23b-3p mature miRNA
• Sequence: 58 - AUCACAUUGCCAGGGAUUACCAC - 80
• Evidence: experimental ; cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739