Stem-loop hsa-mir-23b

Accession

MI0000439

Symbol

HGNC: MIR23B

Description

Homo sapiens hsa-mir-23b precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Hsa-mir-23b is a microRNA that has been identified as significantly down-regulated in the saliva of patients diagnosed with Intraductal Papillary Mucinous Neoplasms (IPMN) [PMC5788610]. This preliminary finding suggests that hsa-mir-23b, along with hsa-miR-23a, could potentially serve as a biomarker for IPMN, aiding in the decision-making process for the management of this condition [PMC4486170]. The presence of hsa-mir-23b in saliva offers a non-invasive diagnostic tool, which could be advantageous for patient care and monitoring [PMC4486170]. The down-regulation of hsa-mir-23b contrasts with other microRNAs that were found to be up-regulated in the same study, indicating a possible unique role for hsa-mir-23b in IPMN pathology and its potential utility in distinguishing this condition from others [PMC5788610].

Literature search

292 open access papers mention hsa-mir-23b
(1581 sentences)

Sequence

734253 reads, 4243 reads per million, 135 experiments

cucaggugcucuggcugcuUGGGUUCCUGGCAUGCUGAUUUgugacuuaagauuaaaAUCACAUUGCCAGGGAUUACCACgcaaccacgaccuuggc
.(((((.(.(((((.(((.(((((((((((((((.((((((..............)))))))).))))))))))..))).))).))).)))))))).

Structure

c     u c  -   c   u   --          -  C      gugacu 
 ucagg g uc ugg ugc UGG  GUUCCUGGCA UG UGAUUU      u
 ||||| | || ||| ||| |||  |||||||||| || ||||||       
 gguuc c ag acc acg ACC  UAGGGACCGU AC ACUAaa      a
c     - -  c   a   C   AU          U  -      auuaga 

Annotation confidence Not enough data

Genome context

chr9: 95085208-95085304 [+]

Clustered miRNAs

3 other miRNAs are < 10 kb from hsa-mir-23b

Disease association

hsa-mir-23b is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-23b is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-23b is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-23b-5p

• Accession: MIMAT0004587
• Description: Homo sapiens hsa-miR-23b-5p mature miRNA
• Sequence: 20 - UGGGUUCCUGGCAUGCUGAUUU - 41
• Evidence: experimental ; cloned [3]

Mature hsa-miR-23b-3p

• Accession: MIMAT0000418
• Description: Homo sapiens hsa-miR-23b-3p mature miRNA
• Sequence: 58 - AUCACAUUGCCAGGGAUUACCAC - 80
• Evidence: experimental ; cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739