We have generated a dot-bracket structure for each sequence using RNAfold.
Unambiguous secondary structure.
Parsed and ASCII art drawn.
Want the script? Email us or visit Downloads or something.
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR1-2, a microRNA, was found to induce differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) into cardiomyocytes by activating the Wnt/β-catenin signaling pathways [PMC5424345]. This study demonstrated that the over-expression of MIR1-2 in BMSCs effectively promoted cardiomyocyte differentiation with less cytotoxicity compared to the use of 5-aza, a commonly used differentiation inducer [PMC5424345]. Copy number assays were used to measure the expression levels of various genes, including MIR1-2 and other genes involved in cell cycle regulation and proliferation [PMC7083839]. The specific copy number assays used were as follows: MIR1-2 (Hs06506989_cn), CCND1 (Hs00377865_cn), CCND2 (Hs00394283_cn), CCND3 (Hs02982157_cn), CDKN1B (Hs02136152_cn), CDKN2A (Hs03714372_cn), CDK4 (Hs01071103_cn), and CDK6 (Hs00389416_cn) [PMC7083839]. These assays were purchased from Thermofisher, a well-known supplier of molecular biology reagents [PMC7083839]. Overall, this study provides evidence that MIR1-2 can effectively induce BMSC differentiation into cardiomyocytes through Wnt/β-catenin signaling pathways and suggests its potential as a therapeutic approach for cardiac regeneration [PMC5424345].
a c ac ug aca
ccuacu agaguacauacuucuuuaugu ccaua a u
|||||| ||||||||||||||||||||| ||||| |
ggaugg uuuUAUGUAUGAAGAAAUGUA GGUau u a
c u -A cg aac
Annotation confidence
High
Do you think this miRNA is real?
Please write your comment
Comments
Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].
PubMed ID:
17604727
A mammalian microRNA expression atlas based on small RNA library sequencing
"Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
"Cell (2007) 129:1401-1414