Stem-loop hsa-mir-1-2

Accession

MI0000437

Symbol

HGNC: MIR1-2

Description

Homo sapiens hsa-mir-1-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR1-2 is a microRNA that, when overexpressed in bone marrow stromal cells (BMSCs), has been shown to steer these cells towards cardiomyocyte differentiation by activating the Wnt/β-catenin signaling pathway [PMC5424345]. This differentiation process is more effective and exhibits lower cytotoxicity when compared to the use of 5-azacytidine, a chemical that induces DNA demethylation [PMC5424345]. The study utilized copy number assays for MIR1-2 and other genes involved in the cell cycle regulation to confirm these findings [PMC7083839].

Literature search

520 open access papers mention hsa-mir-1-2
(2664 sentences)

Sequence

6897451 reads, 5211 reads per million, 153 experiments

accuacucagaguacauacuucuuuauguacccauaugaacauacaaugcuaUGGAAUGUAAAGAAGUAUGUAUuuuugguaggc
.((((((.(((((((((((((((((((((..(((((..(........)..))))).))))))))))))))))))))).)))))).

Structure

a      c                     ac     ug aca 
 ccuacu agaguacauacuucuuuaugu  ccaua  a   u
 |||||| |||||||||||||||||||||  |||||  |    
 ggaugg uuuUAUGUAUGAAGAAAUGUA  GGUau  u   a
c      u                     -A     cg aac 

Annotation confidence High

Comments

Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr18: 21829004-21829088 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-1-2

Disease association

hsa-mir-1-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-1-3p

• Accession: MIMAT0000416
• Description: Homo sapiens hsa-miR-1-3p mature miRNA
• Sequence: 53 - UGGAAUGUAAAGAAGUAUGUAU - 74
• Evidence: experimental ; cloned [2], Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739