MIRLET7I is a microRNA implicated in various biological processes and diseases, including sepsis and cancer [PMC8358855]'>PMC8358855], [PMC6701281]. It is located in a CpG island, and the single nucleotide polymorphism (SNP) rs10877887 in its promoter region may affect its expression through epigenetic mechanisms [PMC9708458]. This SNP has a minor allele frequency of approximately 40%, indicating its common occurrence in the population [PMC9708458]. In sepsis patients, MIRLET7I levels are reduced in plasma, suggesting its potential as a biomarker for this condition [PMC8358855]. Additionally, MIRLET7I has been found to be downregulated in ovarian cancer patients and may serve as a discriminant between benign and malignant ovarian diseases [PMC6701281]. Bioinformatic analyses have shown that MIRLET7I targets genes related to cardiovascular development despite being less frequently expressed compared to other miRNAs [PMC7912193]. It is also found within extracellular vesicles (EVs), indicating its role in intercellular communication [PMC7912193]. Moreover, MIRLET7I dysregulation has been associated with various stages of HIV-1 infection and may interact with viral proteins to affect immune response and viral replication [PMC4761210].
c U U -------- u ugu uggc GAGGUAGUAGUUUGUGC GUU gg cgggu g |||| ||||||||||||||||| ||| || ||||| a aUCG UUCCGUCAUCGAACGCG Caa uc gcccg c - - U uagaggug - uua
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000415 |
Description | Homo sapiens hsa-let-7i-5p mature miRNA |
Sequence | 6 - UGAGGUAGUAGUUUGUGCUGUU - 27 |
Evidence |
experimental
cloned [2-3], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004585 |
Description | Homo sapiens hsa-let-7i-3p mature miRNA |
Sequence | 62 - CUGCGCAAGCUACUGCCUUGCU - 83 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|