WARNING: This summary was generated by AI. MIRLET7G is a microRNA that has been identified as having increased expression in canine and human mammary tumor cell lines, suggesting a potential role in tumorigenesis [PMC9210832]. It is not commonly found in human retinoblastoma tumors, but it is present in 31 out of 31 HRO tumors, although these are not specified as retinoblastoma tumors [PMC5423597]. Additionally, MIRLET7G is among the top differentially expressed genes in certain cell types, highlighting its importance in cellular processes [PMC9730279]. It has been implicated in the regulation of key stem cell factors and differentiation processes such as adipogenesis and osteogenesis [PMC4951121]. MIRLET7G expression is also influenced by estrogen via ESR1, suggesting hormonal regulation of this microRNA [PMC6333457]. Furthermore, it plays a role in autophagy by targeting IGF1R and modulating the AKT-MTOR pathway [PMC6333457]'>PMC6333457], and its expression can be suppressed by estrogen through a MAP2K/MEK-MAPK-dependent pathway [PMC6333457]. MIRLET7G has been included in custom gene panels for mutation profiling of pediatric cancers due to its relevance to cancer biology [PMC7341754], indicating its potential as a biomarker or therapeutic target.
a U A ugagg -a a a ggc GAGGUAGU GUUUGUACAGUU gucu ug uacc c ||| |||||||| |||||||||||| |||| || |||| cCG UUCCGUCA CGGACAUGUCaa uaga ac augg c a - C ----- gg - c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000414 |
| Description | Homo sapiens hsa-let-7g-5p mature miRNA |
| Sequence | 5 - UGAGGUAGUAGUUUGUACAGUU - 26 |
| Evidence |
experimental
cloned [2-3], Illumina [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004584 |
| Description | Homo sapiens hsa-let-7g-3p mature miRNA |
| Sequence | 62 - CUGUACAGGCCACUGCCUUGC - 82 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|