miRBase entry: hsa-let-7g

Stem-loop hsa-let-7g


Accession
MI0000433
Symbol
HGNC: MIRLET7G
Description
Homo sapiens hsa-let-7g precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIRLET7G is a microRNA that has been identified as having increased expression in canine and human mammary tumor cell lines, suggesting a potential role in tumorigenesis [PMC9210832]. It is not commonly found in human retinoblastoma tumors, but it is present in 31 out of 31 HRO tumors, although these are not specified as retinoblastoma tumors [PMC5423597]. Additionally, MIRLET7G is among the top differentially expressed genes in certain cell types, highlighting its importance in cellular processes [PMC9730279]. It has been implicated in the regulation of key stem cell factors and differentiation processes such as adipogenesis and osteogenesis [PMC4951121]. MIRLET7G expression is also influenced by estrogen via ESR1, suggesting hormonal regulation of this microRNA [PMC6333457]. Furthermore, it plays a role in autophagy by targeting IGF1R and modulating the AKT-MTOR pathway [PMC6333457]'>PMC6333457], and its expression can be suppressed by estrogen through a MAP2K/MEK-MAPK-dependent pathway [PMC6333457]. MIRLET7G has been included in custom gene panels for mutation profiling of pediatric cancers due to its relevance to cancer biology [PMC7341754], indicating its potential as a biomarker or therapeutic target.

Literature search
1077 open access papers mention hsa-let-7g
(6050 sentences)

Sequence

2546639 reads, 5323 reads per million, 153 experiments
aggcUGAGGUAGUAGUUUGUACAGUUugagggucuaugauaccacccgguacaggagauaaCUGUACAGGCCACUGCCUUGCca
.(((.((((((((.((((((((((((.....((((.((.((((....))))))..)))))))))))))))).))))))))))).

Structure
a   U        A            ugagg    -a  a    a 
 ggc GAGGUAGU GUUUGUACAGUU     gucu  ug uacc c
 ||| |||||||| ||||||||||||     ||||  || ||||  
 cCG UUCCGUCA CGGACAUGUCaa     uaga  ac augg c
a   -        C            -----    gg  -    c 


Annotation confidence High
Do you think this miRNA is real?
Comments
let-7g-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr3: 52268278-52268361 [-]

Disease association
hsa-let-7g is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7g-5p

Accession MIMAT0000414
Description Homo sapiens hsa-let-7g-5p mature miRNA
Sequence 5 - UGAGGUAGUAGUUUGUACAGUU - 26
Evidence experimental
cloned [2-3], Illumina [4]
Database links
Predicted targets

Mature hsa-let-7g-3p

Accession MIMAT0004584
Description Homo sapiens hsa-let-7g-3p mature miRNA
Sequence 62 - CUGUACAGGCCACUGCCUUGC - 82
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739