miRBase entry: mmu-mir-106a

Stem-loop mmu-mir-106a


Accession
MI0000406
Symbol
MGI: Mir106a
Description
Mus musculus mmu-mir-106a precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Literature search
99 open access papers mention mmu-mir-106a
(395 sentences)

Sequence

8909 reads, 61 reads per million, 82 experiments
auguCAAAGUGCUAACAGUGCAGGUAGcuuuuugaguucuACUGCAGUGCCAGCACUUCUUACau
((((..(((((((..((.(((((..(((((...)))))...))))).))..)))))))...))))

Structure
    -CA       AA  G     -GU     u 
augu   AAGUGCU  CA UGCAG   AGcuu  
||||   |||||||  || |||||   ||||| u
uaCA   UUCACGA  GU ACGUC   uugag  
    UUC       CC  G     Auc     u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 52742503-52742567 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-106a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-106a-5p

Accession MIMAT0000385
Description Mus musculus mmu-miR-106a-5p mature miRNA
Sequence 5 - CAAAGUGCUAACAGUGCAGGUAG - 27
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-106a-3p

Accession MIMAT0017009
Description Mus musculus mmu-miR-106a-3p mature miRNA
Sequence 41 - ACUGCAGUGCCAGCACUUCUUAC - 63
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009