MIR200B is a microRNA implicated in various cellular processes, including the regulation of epithelial to mesenchymal transition (EMT) and the maintenance of epithelial characteristics [PMC6656769]. The epigenetic regulation of MIR200B is evident from bisulfite sequencing studies that have characterized its promoter region [PMC4921922]. The expression levels of MIR200B are inversely correlated with EMT scores in various cell lines; cell lines with lower EMT scores exhibit higher levels of MIR200B [PMC6656769]. However, the statement that MIR200B is regulated by ANRIL in the context of diabetic retinopathy is not supported by the provided context [PMC8427604]. Additionally, the claim that low expression levels of MIR200B in cancer stem cells from Hep-12 suggest a role in inhibiting stem cell-associated microRNAs is not substantiated by the context [PMC7376200]. miPEP200a can downregulate vimentin expression without activating miR200a and MIR200B, indicating a mechanism independent of these microRNAs [PMC8038077]. Differential methylation regions (DMRs) have been identified that target the MIR200 family including MIR200B in uterine carcinosarcoma (UCS), indicating that epigenetic modifications can affect its expression [PMC5237802]. Exposure to tobacco carcinogens has been shown to epigenetically silence MIR200B in lung epithelial cells and contribute to EMT phenotypic changes [PMC3763404].
 
                            cca uc ag g c - C ug gu gc gggc ccgu g CAUC UUACUGGGCAG AUUGGA ga c || |||| |||| | |||| ||||||||||| |||||| || cg cccg ggcg c GUAG AAUGGUCCGUC UAAUcu cu a gca -u -a g A U A -- gg
| Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0004571 | 
| Description | Homo sapiens hsa-miR-200b-5p mature miRNA | 
| Sequence | 21 - CAUCUUACUGGGCAGCAUUGGA - 42 | 
| Evidence | experimental cloned [4] | 
| Database links |       | 
| Predicted targets |       | 
| Accession | MIMAT0000318 | 
| Description | Homo sapiens hsa-miR-200b-3p mature miRNA | 
| Sequence | 57 - UAAUACUGCCUGGUAAUGAUGA - 78 | 
| Evidence | experimental Northern [1], cloned [2-5] | 
| Database links |       | 
| Predicted targets |       | 
| 
 |